Busch Lab

ZMP

slco1f2

Ensembl ID:
ENSDARG00000078354
ZFIN ID:
ZDB-GENE-080305-3
Description:
solute carrier organic anion transporter family, member 1F2 [Source:RefSeq peptide;Acc:NP_001121745
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30492 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30493 Nonsense Mutation detected in F1 DNA Not yet available
sa38231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30492
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Essential Splice Site 149 606 4 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 134386)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75910982
GRCz11 4 77296236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACATGCTCATCCGACTCTCAGAAAACTCTTCAACAGCCTTTTTCTGG[T/A]AATGCGTTATGTGTAGAAAAGCATAGGAGTTATTTGTTTAATGCAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Nonsense 335 606 8 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 138410)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75906958
GRCz11 4 77292128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCGTACAGTATAGTGGCATTCAACGACTTCGCCATACTTGTAACGTA[C/A]ACGCCAAAGTATCTGGAACAGCAGTTTGGGCAAAGCGCATCCAAAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38231
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Nonsense 520 606 11 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 139223)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75906145
GRCz11 4 77291315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCCCAACTGCAACAGAATGATGTACCTTTATCTGGGATTGCAGTCTT[T/A]GGCCCTCTTTGTGTACAGTCTTGGTGCTGTTCCCCTTTTCACCATGTCTC
Associated Phenotype:
Not determined