Busch Lab

ZMP

si:dkey-13f9.6

Ensembl ID:
ENSDARG00000078335
ZFIN IDs:
ZDB-GENE-030131-7487, ZDB-GENE-091204-390
Human Orthologue:
AMOT
Human Description:
angiomotin [Source:HGNC Symbol;Acc:17810]
Mouse Orthologue:
Amot
Mouse Description:
angiomotin Gene [Source:MGI Symbol;Acc:MGI:108440]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa1663 Nonsense Available for shipment Available now
sa3123 Nonsense F2 line generated Not yet available
sa12125 Essential Splice Site Available for shipment Available now
sa12810 Nonsense Available for shipment Available now
sa16908 Nonsense Available for shipment Available now
sa3119 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1663
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 12 968 1 10
ENSDART00000141096 Nonsense 12 606 3 7
Genomic Location (Zv9):
Chromosome 21 (position 36839933)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37829282
GRCz11 21 37514469
KASP Assay ID:
554-1610.1 (used for ordering genotyping assays)
KASP Sequence:
GTCACGAGATCTGGAAATGAGGGCAGCAGCCTCAGTTTCCGAGGACACAT[C/A]GGCTAAYAACAGYGGTGGGAGTGGACACACGGTTCTGCAGCGGCTCTTGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3123
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 64 968 1 10
ENSDART00000141096 Nonsense 64 606 3 7
Genomic Location (Zv9):
Chromosome 21 (position 36840088)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37829437
GRCz11 21 37514624
KASP Assay ID:
554-2955.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAAGGTCCAGTAAGCGGATACCCAGGGCCTGGCAGCCCAGCAGAC[G/T]AGCACTCGATGGTCCCACACATTGCGCGACAAGAGCCTCAGGGCCAGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4960
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 423 968 2 10
ENSDART00000141096 Nonsense 423 606 4 7
Genomic Location (Zv9):
Chromosome 21 (position 36841702)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37831051
GRCz11 21 37516238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTCCACATGCTCCAGCACCAGTACCACCAACAGGGCCCCNNNCAGCAG[C/T]AGCAACAGAGTCCAGCACAACACTACTCACAWCCACWCTCCATGCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12125
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Essential Splice Site 479 968 3 10
ENSDART00000141096 Essential Splice Site 479 606 5 7
Genomic Location (Zv9):
Chromosome 21 (position 36842473)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37831822
GRCz11 21 37517009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCTGTTTTGTTGTTTCTGTGAGGCCTCAGCAATGTAAWCTCTTTACA[G/T]ATGGAGACTGAGATCCAGATGGTGTCAGAAGCTTACGAGAACTTGGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12810
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 553 968 4 10
ENSDART00000141096 Nonsense 553 606 6 7
Genomic Location (Zv9):
Chromosome 21 (position 36852026)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37841375
GRCz11 21 37526562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGCTGCAAAAGAGTGTGAGGGCACAGAGGAYAATCGWAAAACCATCTCA[C/T]AGCTTCWGGWTCAGGGTGAGTGGACCTACAGGTACAAGAAACCCGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 719 968 7 10
ENSDART00000141096 None None 606 None 7
Genomic Location (Zv9):
Chromosome 21 (position 36861016)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37850200
GRCz11 21 37535387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGCGTCATGAGGCAGTTCGCACTGGATGCCGCTGCTTCTGTGGCCACA[C/T]AGAGGTGRACACATWCACTGCTCTACACTGAACATGCRCTGTACAATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3119
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114778 Nonsense 853 968 9 10
ENSDART00000141096 None None 606 None 7
Genomic Location (Zv9):
Chromosome 21 (position 36864702)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37853886
GRCz11 21 37539073
KASP Assay ID:
554-2814.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCAATCTGATTTGCTCCTCTTCATGTTTCAGGTGTTCTGCTGGGTCCA[G/T]AGTTCCGTGGAGACTCTCTGAGAACAGAGTCCATTTCCTCTTCTCCATCT
Associated Phenotype:
Not determined