Busch Lab

ZMP

si:ch73-212j7.1

Ensembl ID:
ENSDARG00000078327
ZFIN ID:
ZDB-GENE-081104-258
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKV3]
Human Orthologue:
KIAA0284
Human Description:
KIAA0284 [Source:HGNC Symbol;Acc:20362]
Mouse Orthologue:
AW555464
Mouse Description:
expressed sequence AW555464 Gene [Source:MGI Symbol;Acc:MGI:2145043]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa10696 Nonsense Available for shipment Available now
sa17237 Nonsense Available for shipment Available now
sa23625 Nonsense Available for shipment Available now
sa9972 Nonsense Available for shipment Available now
sa36946 Nonsense Mutation detected in F1 DNA Not yet available
sa18015 Essential Splice Site Available for shipment Available now
sa8550 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10696
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 732 1687 9 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 Nonsense 159 234 2 3
Genomic Location (Zv9):
Chromosome 20 (position 3153502)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3107364
GRCz11 20 3120204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTWACATTTCACAGGTGTTTGGTGTTTTAGATGCGCCAGAATACAGTGGT[C/T]AGACTCTTGGAGTTTATAGGCCTGTGATTGATGATGGGGACAATGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 787 1687 10 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 Nonsense 214 234 3 3
Genomic Location (Zv9):
Chromosome 20 (position 3153782)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3107644
GRCz11 20 3120484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TKTAAAACATAMCTTTTGTAATTTAGGCACATCCTGGTGTAGTAGGGCCT[A/T]AATGGGTCTCGCGTTGGGCCAGCCTTGCAGACCCTTATAGTGATCCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23625
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 917 1687 11 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 None None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154289)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108151
GRCz11 20 3120991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGACAGTCTGAGTGACACCAGCCGTTCAGATGACAGCTCTATCCTTGAT[A/T]GAAGCGGTAGGAGCCAAGGAAAACGAGGAACTACAAGACACCTACCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 963 1687 11 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 None None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154428)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108290
GRCz11 20 3121130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAACCTACACCCAAACCCACTTCATTTTATATCGGTTCTGAGGATGGTT[T/G]ATCCAAGTCCGATGTGTCCAAAAGYCCAGTTCTTTCACAGCCAGAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36946
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 1101 1687 11 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 None None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3154841)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3108703
GRCz11 20 3121543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTGTCTGGATGTAGTCAACGATCAAAAAAAGGAAGCTCTCCTGCA[C/T]AAGAAGACTCCTTTTCTGGTGACTCAGATGTGGATACTGCCAGTACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Essential Splice Site 1378 1687 11 18
ENSDART00000132972 None None 202 None 6
ENSDART00000133435 None None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3155676)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3109538
GRCz11 20 3122378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACTCCTCCCRTACCCATTCTACCCAAGTTAAWCACAGTAGCACAGCTG[G/A]TAGGTATTAGTCARTTTATTTCTCTTATGCTGTGTTCACACCAGACGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8550
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112848 Nonsense 1521 1687 14 18
ENSDART00000132972 Nonsense 66 202 2 6
ENSDART00000133435 None None 234 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3160106)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3113968
GRCz11 20 3126808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATTAAKCTGCAGCTGGTACAGCATATACCCGAGGCAAGTTTGAACTA[T/A]CAAAAGGTTCCTCCAGGCTCAACTAGTCCAAWAGACCAGGACTCAAATAT
Associated Phenotype:
Not determined