Busch Lab

ZMP

arhgap10

Ensembl ID:
ENSDARG00000078326
ZFIN ID:
ZDB-GENE-060512-221
Description:
rho GTPase-activating protein 10 [Source:RefSeq peptide;Acc:NP_001038715]
Human Orthologue:
ARHGAP10
Human Description:
Rho GTPase activating protein 10 [Source:HGNC Symbol;Acc:26099]
Mouse Orthologue:
Arhgap10
Mouse Description:
Rho GTPase activating protein 10 Gene [Source:MGI Symbol;Acc:MGI:1925764]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39645 Nonsense Mutation detected in F1 DNA Not yet available
sa32716 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24852 Nonsense Mutation detected in F1 DNA Not yet available
sa6595 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25621 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39645
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 12 764 1 23
Genomic Location (Zv9):
Chromosome 1 (position 36480498)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36040356
GRCz11 1 36772383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGTCCAGTAAAAATGGGTTTACACCCGTTGGAGTTCAGTGAATGTTA[C/A]CTGGACAGTCCTGCTTTCAGGGACAAAATCAAAGCTCATGAAGCAGAGCT
Long Flanking Sequence:
CTCCGTTGTTCCCCCTCAAAAAAATCCCGATTTTCCAGAGAGCCAAGCGTGATGACGTGATGGCAGAAAAAGCCCCGGAGTCCTGCACGCGGGAGGAGACTCGCGCTCGACTGTCATTCGCGGACCAAAAACCACACTGGATATTATTACCTCTATTTCAAGCGATATCGGTGTAGCCCAGAGCTGTTTTATCTTATCATACACGAGTTTAAACCCGGGATTTACTTAATCCAGCCAGGACTAAGTTTACTCGTGCGCCTTTGGAAAGAGTTCCATTCCCAAGAGGAGTCCCGACGCGTTTAGTCTTCCTAAAATACACGAGCACGCGTTAGAAACGACTTTTTAACAACAGCCTTTTTATTCAGCTTCTTGATTTGACCATTTTTTGTATTTATTCATTCGCTGGTCGCTTTGTAACGGGATTTAAACGCTAGCTAGTCTTTAAACTAGCTGAGTCCAGTAAAAATGGGTTTACACCCGTTGGAGTTCAGTGAATGTTA[C/A]CTGGACAGTCCTGCTTTCAGGGACAAAATCAAAGCTCATGAAGCAGAGCTGGAAAAAACAGGCAGATTCATCAAAGAGTTGTACAAAGATGGAAAGAATCTCATCAATGCCACCAAACGTAAGTGTCCTGTCATTTTGGCTCTGCTTTAAAACCCATAAAGAATTGTGTATCAAATGAAGAGACAATTTTCCATTTAGTCAATGTTTTATTCATGTTATACAAGTGTAATTTAATATCAACAACTCCAATCAGGCAGTTTTTGTGTGTTTGGTCAAGGTCATCACCATGTCATTACTGTTTCCACTACTCGAGAGGTTAAAAAACTGCTAGGTTAAAAAAGCACACCGTTCATTTGGTGTATATAAAATGAGCTTGCGTGGCATAACACTTGCTGACCTCACCCGTTTTTTTGTGTGTGTTATGATTCACACTAATTATGTGCAAATCGTCAGGTGTTTCAAGTTTGCATTTTGATCAGGTTGCATTAAGGATCTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32716
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 128 764 4 23
Genomic Location (Zv9):
Chromosome 1 (position 36538286)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36098144
GRCz11 1 36830171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGCCCTTAGAAAACTTTCGAAAAGAGCATCTTGGCTCAGCAAAG[G/A]TAAATTCGGTTTCAGATCATCTCTCATTATTTATTAAATATAGGATGTTT
Long Flanking Sequence:
ACAGTTGTTAATCGCTCCCTGCCTTCTCCCCTGCTCTGCTGGCCACGCACACTCCTCCCTCTGAACGCGGAGCTCCGTGCCCATTATGATGCATTTTTTGAAAAAAATTCTCTATGCTCTTTGAGTTAATTGAAAGCCTTGTTGTGTTATCCAACTCATGCAGTGGGGAAGTTCTTACTGCATCAATGGTTGAATGCTGTCATATGAACAATATTAATGCAGTTTTGAAGAAATTTGTGGAGCTTTCGGCATTTACAGTTTCATTGCAGCTTTACTTATCATTGTGAATTCTCTTTTTACAGTATCAAATGACTAGAGGTAACCATATTGCTGGTGGATGACATTGTTTCAAACTGGAATTTACTATTTGTGCAAGTTATGAAAAAGAAATAATGAATTAATAATTATTACCAAATTGTGTTTCACAGATGAGAAACATCACAGAGACACTGATGAAGCCCTTAGAAAACTTTCGAAAAGAGCATCTTGGCTCAGCAAAG[G/A]TAAATTCGGTTTCAGATCATCTCTCATTATTTATTAAATATAGGATGTTTGCACTAGAGGAAGTGAAAACATATGTTTATATATGAAGAGTTCAGATGCAAAAACCTCTAAGTGTCATCTGAATTTTTTTTTCTAATATTAGCATATTTCTCAGGATCCTTTGTCTTGATTTAGTAATTTTACTTTTATGGTAAAGAATAGGTTATTTTCATCACTTTTAACATGAAATAACTGAACATAAACATAAGAGGCTGAATAAAATGCTCATTCTAGAAGAGAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCAGATGCAAAAACCTCTAAGTGTCATCTGAATTTTTTTTTCTAATATTAGCATATTTCTCAGGATCCTTTGTCTTGATTTAGTAATTTTACTTTTATGGTAAAGAATAGGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25620
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 172 764 6 23
Genomic Location (Zv9):
Chromosome 1 (position 36544732)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36104295
GRCz11 1 36836322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTTGTCTGTCCATCATGTAGGCTGATGTGTCGGTGGAACTGATGCGA[C/T]AGCACTTTCAGGAGACCTCTCTAGAGTATGTTTGCAAACTGCAGGAGATA
Long Flanking Sequence:
GTTTTAGATTACTACATTTTTTATCTTAATGACATCAGCAGATAATTCACCACAAAACTAGCAAAAATCATTATGGTTAGTAATGTGTGCTTTAAGAGTTTTATTTCTGCATGTAAAGACACTTTAAACCTAATGTTTTTTTTAGTTATTGTTATATATATTCTTTAAAGTCCATATACTGTTGCTAACATTACTGTGATTTACTGTATTTGCACAACTAATTAACTATTTATCAATTAATTAACTATTTTACAGTAATTTCCTTTGTTGGTTACATTGTCATCACACTTTGCACAATTACTTCCATTTTCAGAAGATGGCCCTCTGTGTTTTAACCCAGGTTGACACAGAAAAAAGACAACTTTTGGAAAAACCCATTTGGCCATCAGCCTGCTTTAAGTCTTCCCCTTTTTTCCTTCAATCTTTAATCTGAACTGTAAAGCTTTTTTTGTCTTTGTCTGTCCATCATGTAGGCTGATGTGTCGGTGGAACTGATGCGA[C/T]AGCACTTTCAGGAGACCTCTCTAGAGTATGTTTGCAAACTGCAGGAGATACAGGAGAGGAAGAAGTTTGAGTGTGTTGAACCTGTAAGTGCACGACCCATCATCCTCATGGTCATTGAACCTAATCGATTTCTTCATTGTTTGCTGATGGATTTAGCTGTAGGGGGAAAAACTCACACACATTTGATAAAATATACAGTTTAAGTCAGAATTATTAGTGCCCCATATATCATATATATATATATATATACACACACACACACACAAAATTTCTGTTTAATGGAAAGATTTTTTCAGCGGGTTTCTTAATTTCTAATAACTCATTTCTAATAACTGATTTCTTTTTTCTTTGCCTTGATGATAGTACGTATTATTTTACTAGATAATTTGCAAGATAATAATATTCAGCTTATATTGCAATTAAAAGGCTTAACTAAGTTAATTAGGCGTGTTAGAGTACTTGGGTAAATCATTGTATAACAGTGTTTTGTTCTGTAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 375 764 12 23
Genomic Location (Zv9):
Chromosome 1 (position 36553120)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36112683
GRCz11 1 36844710
KASP Assay ID:
554-7825.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTCTGGTTTGTGTTTTCTGATGTTTATCTCTCTCATGCAGATGCAGTG[T/A]CTCAACCGGACACATTCAAGAGAAAGAGGAAGTAAGAGACCAAATTAACA
Long Flanking Sequence:
TTTATTTATTTATTATTATTTTTATTTTTTTTACTTAACATATGCTTATTTAAAACAGTTTCCTGGCCTGACTAATAGTTAACACCACAAATCTTTACATTGTTACAAAATACTCTTCTATGCATTAATTAATTAAAAACCTCAAAAGCTGCAGTTTTTATTTATTTTTTACTTTTTACATTTTTATAAAGTATTCTTTTCTATTCATCAAATTATAAATAAATAAATACACATTAATTAATTACATTTAATTTTTTATTTTTTTCAGAATTACATTTTATTATTTTACAGTATGTTTGATGAATGCAGCCTGGTGAGCATTAAAGACTTAAAAAGACACACATAGTCCCTAGCATTTTCAACAGTAGTTAACTGTAACATGTTTAATGTTAAATAGTAGTCTCTTGTTTGGTTTATAAATTGTGCTCCGTTTGCTGTGGTGTTTCATGTGGGTCTGGTTTGTGTTTTCTGATGTTTATCTCTCTCATGCAGATGCAGTG[T/A]CTCAACCGGACACATTCAAGAGAAAGAGGAAGTAAGAGACCAAATTAACATCAAACTTCATAGTTTATGAGTAATGCTTATACGCATTCTAATGAAATATGTGTGTATTTCCGTAGTTGACGCACAGTTGGATGACGTGGGAATAAGCTTTGTGAAAAACTCAATAAATGCCATTGAAGCCAGAGGTAAGTCTTTGCTGTGAATATTAAATGTGAAAATAATATTTCAATTAAAGATAATAAACAGAAGCAAAATGTATCAGGCAGGATGTGTATTTTCTGTCAGCAAAGGAAGTCCCATTTGCACATGGTTTATTTAATGTAGTAACACCATGTTAACACTAGAGGGCAGAATTATCTAGCAGATTTTCTCAGCTAACGCTAAAAACATGTTGGGATTTGTTCAGGAGATATGTTGGTGCACTTCTGATTAGTTTGGTGCTTCAGCTGGAATGTGTGTGTGTATGTATTGCCAATCTAACACGGCAAAATAATGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6595
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 481 764 16 23
Genomic Location (Zv9):
Chromosome 1 (position 36565522)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36125085
GRCz11 1 36857112
KASP Assay ID:
554-4100.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGCCTCTAATGACATACGAGCTGTATAAGGAGTTCATCGTCCCTGCAA[G/A]TAAGGTCTTTGTCCTTGCTTTGACAATAATCAAGYAATACCCAAAACGAA
Long Flanking Sequence:
AAAAAATGAATGAATAAATGTTAACTGTTAAATGTGTCATGGGGAAATATGCTTTTTAAATGATTTGTCAGATTCACAGTGGGACATTCCTTCCAGTGTCATGTAATTAATTAATTCAACATTCAATTAATTTTCTGATTGATGCGGTGCAATAAAGTAGCAGACGGCAGATTTTATAGGAGGGCATCACTTTTGTCTTTGTACTCCACTACAAGTATGAATGATGTTGGTTTGCTGGGCTCATTTTGGGCTAACGTTGCCGGGACGGGTGCCAGACACTGAGCGAATGTACCTTCAGATGAACTTGGTCCTGAACAGTGTGTATGTGCGTTTGTGTGCTCGTCTAATTTCTTGCCGTGATCAGCCACATTAATCATAGTGTTGTGTATATAATAATGCCCAATAAAGCCAATAAATCTCTCCCCCTCTGTTTCTCTCAAGGAGCCTTCCAGAGCCTCTAATGACATACGAGCTGTATAAGGAGTTCATCGTCCCTGCAA[G/A]TAAGGTCTTTGTCCTTGCTTTGACAATAATCAAGTAATACCCAAAACGAATCAATTATTTGACAAATGCTGTAAACCTAGAAAATGTGAATGTCTCTGGGAAAAGAGTGCATGATTTGGAGAATTCTAAATGGGGTTAATGCTTTTAGAAAAGTGTGGCTGAATTTAATTTAGTAAAGGAATTTAGAAAAATAACTTCAGCCAGAAAATATAAACTCACCGGCCACTTTATTAGGTACACATGTCCAACTGTTTGTAACGCAAATTTTGAATCAGCCGATTACACGGCAGCAACTCAATGCATTTAGGCATGTAGACATGGTTGAGAATCTTCTGCAATTTAAACCAAACATCACAATGGGGAAGCAAGGTGATTTAAGTGACTTTGAATGTGGCATGGTTGTTGGTGCCATATGGGCTGGTCTGAGTGTTTCAGAAACTGATGATCTACTACGATTTTCATGCACAACCATCTTTAGGGTTTACAGAGAATGGTCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25621
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Essential Splice Site 570 764 18 23
Genomic Location (Zv9):
Chromosome 1 (position 36575648)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36135211
GRCz11 1 36867238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAGAACATTGTGGTGGAAATTCTCATAGAACAGCATGAAAAGG[T/C]GAGTGACAAGTTACACATAATGAGTGAGCTTTATTTATTGATTTTCAAAC
Long Flanking Sequence:
AAAAGAAAGGAAATCTTGAGACAAATCAAGTTTTAGATTTTTCTGCCAACCTTCTCCTCCCTAATGCAAGTTATTTATGTCATAAATCAACCTCTCTCTCTCTCATTTTTTAATGTCTATAAATATTACAACTAGAGTGAATTAGGCAGTGATCATTGGCAGTGAGATTGAAGATTGTGTTTATACTTTATAATTGGAGGCAAACTGCATTTACTGTCAGAATCAAAACACCCTATCAAACTCAATTGTTTATAAAATGCGAGTCAGTTCTTTTCTTATATTTATCGTGATTATTGTTTAATTTAATTTCTGCTTTTCTTTGTGTGTTTGTGTGTGTAGTGTTGCTGCCAACAGCAAACAGAACCTGATGACGGTGGCGAATCTAGGTGTAGTGTTTGGCCCCACACTCATGAGGCCACAGGAAGAAACCGTTGCAGCCATAATGGACCTCAAGTTCCAGAACATTGTGGTGGAAATTCTCATAGAACAGCATGAAAAGG[T/C]GAGTGACAAGTTACACATAATGAGTGAGCTTTATTTATTGATTTTCAAACTCTCTAACGTTATGCTATACTAAAGTTGAAGTACTTTTATCTGCAGCCAGCAGGGGGAGCTATGTGTGTTTTGACTGGCCGCTATTTAGTTGGCTTCTCTTTCTGATGGCTCAAATACAGTTGGAGCAACATTCTCATTTGACTAAAATACAGGTTAAAACACTGACTTAATCAGCTTTAGTAACAGTAATCTGGTTAATCCTTAAATGGGGTTCATTCTGAGGGACAAAGGCAAAAAGAGTGGGATTACTTCATAATCTCTGAATTATTTAGCCTACATCTGAAACGGGGTGATGAATTGCTTTCATACTATGTGCAATGTTGTGACAGATTATCATATTTCAGTTCAGCTTTCAAAATAAACACTGGCATCTATTAGTCACTTTGGCTGATTAGATCTTTGCATATTTTTTTAGGGTTGCCTAAAGTTGTTTATTTAATAATAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109314 Nonsense 627 764 20 23
Genomic Location (Zv9):
Chromosome 1 (position 36596242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36155805
GRCz11 1 36887832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTKCTGCTTGCTGTGACAGTGTCTCCATCCYCTGAGAGTGYAGGCCTGTG[T/A]AATGATGAGACATCAGTGGGCAGTAATGAGTCAGTCTCCTCCCAGTCMTC
Long Flanking Sequence:
TGGGTGCACCCAAAGCAAACCTCCCCAAACTCTGCAATGATGTCACATTTGCCGCACGCTCTTAAGCGAAATAGGGGACGTGTCGAGTATAAACCAGGCTTACCATTTAAGTTATTGCTAGTATGAATAACGCAGCAGCCACATCGGTTGGCCTAAATCTTTTTTTTTTAAACATAATTATTACTTGAAGCCCATAAATGCATAAAAAATAAGGAAGCATAAGAGAATCTTTTTTTTTTCCTATTTGAGTAAAAAATGAGAAAATCTTTTTTGAATGTGTTTGATATTTAAAACCAACTTGAGGACAGTTAATTTACTATTTACCTTAAATTAGAAGTTTTCTAGTGGAAAATTCCTATAATGTGTTATTCGTCATGTGAATTCATTTGAACTACATTCCCATTTTTATTTTACGTTTCCATTTTCTCTTTTTTTCTTTCCATGCCATTCTTGCTGCTTGCTGTGACAGTGTCTCCATCCTCTGAGAGTGCAGGCCTGTG[T/A]AATGATGAGACATCAGTGGGCAGTAATGAGTCAGTCTCCTCCCAGTCCTCCAATGCCTCTGGAACGCCTCCTGAGAAATCCAAGAATCACCACACTACCATTAGCACATCCCTGCAAGAAGGCACTGGGTATGTAGCAAATGCTCTCTTCTGTCTCACAAAAAATAGAAATGTAGTTAATTTACTTTATATTTAAAACTAATAAGGTTTTTTATATATAAAAAAAAGAAATTAATTTTGATGTACTTTGCTTTTTAGCTTAAATGTATGTAAAGCTATAATATAATACAGCTATAAAGTTTTAATATAAATATACATAAAGAGCAAAAGCCGCTAAACGCCATTTCCACCAAAAAAGAGATAATGACATTGAGTGAATGCTTTAGGCATATAGTACACCATCAACAAATAGATTTGCTTCAAAACTGAATCACAGCATTAGCGTATTCAGAAATGACAGTTTGTTGGCAAAAGCCGCTAAACGCCACTTCCCTTTGACAG
Associated Phenotype:
Not determined