Busch Lab

ZMP

si:ch211-13f8.2

Ensembl ID:
ENSDARG00000078299
ZFIN ID:
ZDB-GENE-070705-32
Description:
Novel protein similar to vertebrate glycosyltransferase 25 domain containing 1 (GLT25D1) [Source:Uni
Human Orthologue:
GLT25D2
Human Description:
glycosyltransferase 25 domain containing 2 [Source:HGNC Symbol;Acc:16790]
Mouse Orthologue:
Glt25d2
Mouse Description:
glycosyltransferase 25 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2138232]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39768 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa18548 Essential Splice Site Available for shipment Available now
sa6826 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39768
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Splice Site, Nonsense 121 521 3 11
ENSDART00000146547 Splice Site, Nonsense 198 598 4 12
Genomic Location (Zv9):
Chromosome 2 (position 6924061)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7347631
GRCz11 2 7219237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCGACTCAAGAACGCTCTATTCAAACTTCTGGTGTGGCATGACCTCA[C/T]AGGTACAATACGCCTTTTCATCTTTCATTACAAAGACTTCCATTCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Essential Splice Site 122 521 4 11
ENSDART00000146547 Essential Splice Site 199 598 5 12
Genomic Location (Zv9):
Chromosome 2 (position 6926559)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7350129
GRCz11 2 7221735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGCACCACGTGTTGRTAATCTCGAAAATATCTGATTYTTCTTTCWGC[A/T]GGGCTATTATAAGYGAACACCACATTATGTACCCATTCGAACCTGGAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8075
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Nonsense 126 521 4 11
ENSDART00000146547 Nonsense 203 598 5 12
Genomic Location (Zv9):
Chromosome 2 (position 6926573)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7350143
GRCz11 2 7221749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGRTAATCTCGAAAATATCTGATTYTTCTTTCTGCAGGGCTATTATAAG[C/T]GAACACCACATTATGTACCCATTCGAACCTGGAAGCGAACYGGTTGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6826
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110689 Essential Splice Site 290 521 8 11
ENSDART00000146547 Essential Splice Site 367 598 9 12
Genomic Location (Zv9):
Chromosome 2 (position 6932623)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7356193
GRCz11 2 7227799
KASP Assay ID:
554-5008.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTKACACAACATGCCGCTGTCAAAAATGACTTCTTTCTGTTTCTYCTC[A/C]GAGCCATGAATTCAACTCAGCTYAGGACTTTAGGAATTGAGATGCTTCCT
Associated Phenotype:
Not determined