Busch Lab

ZMP

si:dkey-226b20.7

Ensembl ID:
ENSDARG00000078285
ZFIN ID:
ZDB-GENE-090313-250
Description:
Novel protein similar to vertebrate inositide-3-kinase adaptor protein 1 (PIK3AP1) [Source:UniProtKB
Human Orthologue:
PIK3AP1
Human Description:
phosphoinositide-3-kinase adaptor protein 1 [Source:HGNC Symbol;Acc:30034]
Mouse Orthologue:
Pik3ap1
Mouse Description:
phosphoinositide-3-kinase adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:1933177]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38935 Nonsense Mutation detected in F1 DNA Not yet available
sa16590 Nonsense Available for shipment Available now
sa42191 Nonsense Mutation detected in F1 DNA Not yet available
sa42192 Nonsense Mutation detected in F1 DNA Not yet available
sa10642 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38935
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 264 837 4 16
ENSDART00000144020 None None 237 None 6
ENSDART00000148034 Nonsense 263 464 4 7
Genomic Location (Zv9):
Chromosome 13 (position 23253942)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983280
GRCz11 13 23113730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATGATTTGTTTTTCTCTTTTAGATATGCCAGCTGGGGAAGTATCAT[T/A]GACGGTTTATAAAAATCAGTCTGTGTTATGCTCATCAACTGTAACATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16590
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 299 837 4 16
ENSDART00000144020 None None 237 None 6
ENSDART00000148034 Nonsense 298 464 4 7
Genomic Location (Zv9):
Chromosome 13 (position 23254046)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983384
GRCz11 13 23113834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAAATGGAGGAAAKTTGCAGATATCTAAAGAAAGCAACTGATCCAGTG[C/T]AGWTCAWGTGTCAGGTAAWAGCATGAAACAAAYAAAYAGTTGATAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42191
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 315 837 5 16
ENSDART00000144020 None None 237 None 6
ENSDART00000148034 Nonsense 314 464 5 7
Genomic Location (Zv9):
Chromosome 13 (position 23254538)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983876
GRCz11 13 23114326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATTATATTTTCAGGCATTTGATATCACATCAAAGCTCCAAGAGTCGT[T/A]AGATAATTTGCTTGCTACCTCTCTTGAAGAACGGATGCCTGTAAATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 435 837 7 16
ENSDART00000144020 None None 237 None 6
ENSDART00000148034 Nonsense 434 464 7 7
Genomic Location (Zv9):
Chromosome 13 (position 23255816)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22985154
GRCz11 13 23115604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACGCACATTGAGGAATCTCAGAACGCCCCCGAAAGTGAGGACATCTA[T/A]GAGGATATGCTGAGAGCTTCCCAGAACTTCATCTCTGAGTTCGATAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10642
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 825 837 16 16
ENSDART00000144020 Nonsense 225 237 6 6
ENSDART00000148034 None None 464 None 7
Genomic Location (Zv9):
Chromosome 13 (position 23268189)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22997527
GRCz11 13 23127977
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGTTAYGTATCCAATCCATCCCGCCCTGTTCCTCAGAATCCTGCACAA[A/T]GAYCTATACCACCTCCGCCGGTACCCAGACGGACATGGTGARGGTCTGGC
Associated Phenotype:
Not determined