Busch Lab

ZMP

CABP7 (2 of 2)

Ensembl ID:
ENSDARG00000078272
Description:
calcium binding protein 7 [Source:HGNC Symbol;Acc:20834]
Human Orthologue:
CABP7
Human Description:
calcium binding protein 7 [Source:HGNC Symbol;Acc:20834]
Mouse Orthologue:
Cabp7
Mouse Description:
calcium binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2183437]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33539 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33539
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109577 Essential Splice Site 86 179 2 6
Genomic Location (Zv9):
Chromosome 5 (position 12597211)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11007286
GRCz11 5 11507589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGCCTGACAAGTTCAATGGGACCAATTTTGACTCTGTGTTCTGGAAG[G/A]TGACTATTAGCCACTTTTTTTGTATTTCAATAGACAACAGGCACAAAGTC
Long Flanking Sequence:
TTTGAATGGGAATTATTTTTGCGGTCTACTCTAAGATAGGAAATTCATTTCCGTTAACTCATCCAAGCAGATTGTTGTTGTTGTTAATATTTAATATAATGTTTTATAAGGGGTTTTGTGATTTATTTAGATTTCTTTTTGTTTAAATAAGACATGGAAGCCAAATGATTTTATTTATTTTTTTTTGTTTAAGATTCATTACATTCAAATGACAGTTCTACATCATGTTACAGAAAATGCATGAAATTCCTCTGCAGCCATTCTCACTTCAGTTCACAAAATATTAGATTTTTATCAATTTCTGTCTTGATTTTATATCCCAGAGCTCACATCTGGAACGTGATCTCATGCTTGAATGCATCTAATACGTCACGCTCTGTTGTTCAGGAGACGGCCAGGTGGATTTCGAAGAATTCGTGACTCTCCTGGGGCCCAAACTCTCAGCTGCTGGGATGCCTGACAAGTTCAATGGGACCAATTTTGACTCTGTGTTCTGGAAG[G/A]TGACTATTAGCCACTTTTTTTGTATTTCAATAGACAACAGGCACAAAGTCTGCGGTATCTTTCAGTCTCTCTCACACACTGAAGTCAACATTCAACACACTGCTGCCTATGAAATCACACAAATAAACAAAACAAAAAAAGTATATCTTTATTTTTTCTGCTTAATTCGCATTTGCATTTTTATCTCATGCCGATTGGACAATTCAGGTGTTTTTTTTTCCTCTTGTTTTTATTTTTATTGTAGAATTTCAAGATCATTTCTCACTTTTCTGTACATGCATAAAATTGAAGATGCTAAAATGCTAATTCATGGTACTTGTACAACAGTAGGGAAAAATGTGTTTTTGTGTTTACTGTTGTTAACAAATCAACGTTGCTGGTATTTAATATGGATTATATGATAGATGATCTATAAAGAAAACACTGTCTGATGTTTTCTAGAGACGATTGGTTCCCTTTATAGATAAAACTGACCTCCCCAAATTCCCTTTTTTTTAGAA
Associated Phenotype:
Not determined