Busch Lab

ZMP

ENSDARG00000078271

Ensembl ID:
ENSDARG00000078271
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21651
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098844 Nonsense 66 117 2 2
Genomic Location (Zv9):
Chromosome 10 (position 6365436)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6742064
GRCz11 10 6700764
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACCCAGAGTCAAGCCGGACCTTGGCTGATTACATCACAATGACATGG[C/T]GAATTAGTGAAAAGCGAGCACGCCGGTTAATTCGTCAGTTGATCCAAGCT
Associated Phenotype:
Not determined