Busch Lab

ZMP

nphp3

Ensembl ID:
ENSDARG00000078261
ZFIN ID:
ZDB-GENE-091204-117
Human Orthologue:
NPHP3
Human Description:
nephronophthisis 3 (adolescent) [Source:HGNC Symbol;Acc:7907]
Mouse Orthologue:
Nphp3
Mouse Description:
nephronophthisis 3 (adolescent) Gene [Source:MGI Symbol;Acc:MGI:1921275]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11865 Nonsense Available for shipment Available now
sa45010 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44093 Nonsense Mutation detected in F1 DNA Not yet available
sa24446 Nonsense Available for shipment Available now
sa37828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11865
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 142 1302 2 30
ENSDART00000142460 Nonsense 142 1210 3 26
Genomic Location (Zv9):
Chromosome 24 (position 9418639)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9477523
GRCz11 24 9617909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAAGCAAAATACCAAGCCATGGAAAGAGCTGCCACTTTTGAACATGAC[A/T]GAGACAAGGTTAAACGACAGTTTAAGGTATGAGTCTSAGCTGATTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Essential Splice Site 150 1302 2 30
ENSDART00000142460 Essential Splice Site 150 1210 3 26
Genomic Location (Zv9):
Chromosome 24 (position 9418667)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9477551
GRCz11 24 9617937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGCCACTTTTGAACATGACAGAGACAAGGTTAAACGACAGTTTAAGG[T/C]ATGAGTCTGAGCTGATTCATTGAGCATTCCTACCTTGCACAATTCTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44093
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 175 1302 3 30
ENSDART00000142460 Nonsense 175 1210 4 26
Genomic Location (Zv9):
Chromosome 24 (position 9420321)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9479205
GRCz11 24 9619591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAATTCAGGATTTGCTGCGGGCAAAACGAGATCTGGAGTCAAAACTT[C/T]AACAGCTGCAGGCGCAAGGCATTCAGATTTATGACCCAGCAGACTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24446
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 386 1302 8 30
ENSDART00000142460 Nonsense 393 1210 8 26
Genomic Location (Zv9):
Chromosome 24 (position 9426789)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9485673
GRCz11 24 9626059
KASP Assay ID:
2261-8443.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGACAGAAAAGGTGAAAAGGAAGAGGTGTCTACTCTCAGCCCAGCCACC[A/T]GAGACCTGCTAGAGAGAGTGAACAAGGCTGACAGAAGTGCCAAACTTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8032
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 529 1302 12 30
ENSDART00000142460 Nonsense 536 1210 12 26
Genomic Location (Zv9):
Chromosome 24 (position 9433831)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9492715
GRCz11 24 9633101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGGATAGAGTTACAGCAGAAACACTCTCCCAACACCCTCATCCTTTA[T/A]CATTTTACGGGACGTCCTCTCTCTACCAGCACAGAYCCTGTGCTTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110629 Nonsense 1250 1302 29 30
ENSDART00000142460 Nonsense 1163 1210 26 26
Genomic Location (Zv9):
Chromosome 24 (position 9464256)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9523140
GRCz11 24 9663526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCATGCTAATCGCTCTCTTACTTCCTCAGTTACGAAGAGGGTGATTTC[G/T]AGAAGGCTGCTGAACTCTACAAGCGAGCAATGGAAATTAAAGAGGCCGAG
Associated Phenotype:
Not determined