Busch Lab

ZMP

si:ch211-198a12.4

Ensembl ID:
ENSDARG00000078254
ZFIN ID:
ZDB-GENE-090312-123
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A692]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42173 Nonsense Mutation detected in F1 DNA Not yet available
sa38931 Nonsense Mutation detected in F1 DNA Not yet available
sa1784 Nonsense Available for shipment Available now
sa22269 Essential Splice Site Available for shipment Available now
sa31919 Essential Splice Site Available for shipment Available now
sa42174 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42173
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 85 506 1 6
ENSDART00000136024 Nonsense 68 419 1 6
Genomic Location (Zv9):
Chromosome 13 (position 18582179)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18402214
GRCz11 13 18533206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTGACTTGCTTAACCTCCTTTTGTGAAGCGCATCTCCAGGCTCATTA[T/G]GAGTATCCAGCTCTCATGAAGCACAAACTGGTGGCGGCGACAGGGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 112 506 1 6
ENSDART00000136024 Nonsense 95 419 1 6
Genomic Location (Zv9):
Chromosome 13 (position 18582258)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18402293
GRCz11 13 18533285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGCGGCGACAGGGCAACTGCGTGAAAAGATCTGCGGCGAACATGAC[A/T]AACTTCTGGAGGTTTTCTGTCGTTCTGACCAAATGTGTGTTTGTGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1784
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 239 506 3 6
ENSDART00000136024 Nonsense 222 419 3 6
Genomic Location (Zv9):
Chromosome 13 (position 18586413)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18406448
GRCz11 13 18537440
KASP Assay ID:
554-1777.1 (used for ordering genotyping assays)
KASP Sequence:
GACCAATGCAGAGAGACATTTGGCCAGACTAGAGGAAGAGATTACCCTGT[T/A]AAGGAAGAAACACACTGACTTGGAGCAGCTCTCACAGTCTGATGATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22269
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
Genomic Location (Zv9):
Chromosome 13 (position 18588501)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408536
GRCz11 13 18539528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAATTCTCCAGACTGTGGACCCAGCAAAACGAGAGGAGTTCTTTGAAT[G/T]TAAGTTCAGAAATAGTGAGATTCTCATTTTATATAAACACATTGTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
ENSDART00000108779 Essential Splice Site 333 506 5 6
ENSDART00000136024 Essential Splice Site 316 419 5 6
Genomic Location (Zv9):
Chromosome 13 (position 18588501)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408536
GRCz11 13 18539528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAATTCTCCAGACTGTGGACCCAGCAAAACGAGAGGAGTTCTTTGAAT[G/T]TAAGTTCAGAAATAGTGAGATTCTCATTTTATATAAACACATTGTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108779 Nonsense 390 506 6 6
ENSDART00000136024 Nonsense 373 419 6 6
Genomic Location (Zv9):
Chromosome 13 (position 18588751)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18408786
GRCz11 13 18539778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCGACTATTGGCAACAGGCACTGTGTAAGCCGGGTCTGGCAGGAGGA[C/T]GATATTACTGGGAGCTGGACTGGAGAGGCACTGAAGTGGACATTGCTGTC
Associated Phenotype:
Not determined