Busch Lab

ZMP

si:ch211-113e8.3

Ensembl ID:
ENSDARG00000078251
ZFIN ID:
ZDB-GENE-090312-74
Description:
Novel protein similar to H.sapiens testis-specific kinase [Source:UniProtKB/TrEMBL;Acc:B7ZDC6]
Human Orthologue:
TESK1
Human Description:
testis-specific kinase 1 [Source:HGNC Symbol;Acc:11731]
Mouse Orthologue:
Tesk1
Mouse Description:
testis specific protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1201675]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1979 Essential Splice Site F2 line generated Not yet available
sa11795 Nonsense Available for shipment Available now
sa32723 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1848
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 48 657 1 10
ENSDART00000140619 None None 75 None 2
ENSDART00000146680 Nonsense 28 259 1 8
Genomic Location (Zv9):
Chromosome 1 (position 40618498)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39507907
GRCz11 1 40225980
KASP Assay ID:
554-1839.1 (used for ordering genotyping assays)
KASP Sequence:
TGCGCAGTGCCGTGTCCAGCCTGGCACGGATTGACGATTTTTTCTGTGAA[A/T]AAATCGGCTCAGGGTTCTTCTCAGAAGTGTTTAAGGTAAACTTTACTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25633
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 199 657 6 10
ENSDART00000140619 None None 75 None 2
ENSDART00000146680 Nonsense 179 259 6 8
Genomic Location (Zv9):
Chromosome 1 (position 40609750)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39499159
GRCz11 1 40217232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGTGTATAACATGTCTAACTTGTCTACAGTGATGGGGTTGAAAAA[C/T]AACCTTTAGCCGTTGTGGGCTCCCCCTACTGGATGGCTCCAGAAATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1979
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Essential Splice Site 251 657 7 10
ENSDART00000140619 None None 75 None 2
ENSDART00000146680 Essential Splice Site 231 259 7 8
Genomic Location (Zv9):
Chromosome 1 (position 40609509)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39498918
GRCz11 1 40216991
KASP Assay ID:
554-2741.1 (used for ordering genotyping assays)
KASP Sequence:
GATTATTGCTCGAATTGAGGCTGACCCAGATATCCTCCCACGGACAGAGG[T/C]ACATACAACTGTACAGCAGAACATGAAGCACAGAATCAGGCTTAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11795
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 419 657 10 10
ENSDART00000140619 None None 75 None 2
ENSDART00000146680 None None 259 None 8
Genomic Location (Zv9):
Chromosome 1 (position 40604658)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39494067
GRCz11 1 40212140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGAGCCCAGGGCTTCGAGGACCCCCTCGAAGGTGTCGGTCYCTGCCCTG[C/A]ACCCCTGAACTAGGACGAMAGTTACCCTTCAGAGATCAAGAGGTAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112133 Nonsense 455 657 10 10
ENSDART00000140619 None None 75 None 2
ENSDART00000146680 None None 259 None 8
Genomic Location (Zv9):
Chromosome 1 (position 40604552)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39493961
GRCz11 1 40212034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGTGAAGAACTGGGCCAGGAAACGAAAGACAAAGAGTTGGAAGGACAA[C/T]AAGATGCGGTGGAGGACTCAGGCCTGGTTCTGGACTTAGATATGGTGTCT
Associated Phenotype:
Not determined