Busch Lab

ZMP

si:ch211-197l9.2

Ensembl ID:
ENSDARG00000078244
ZFIN ID:
ZDB-GENE-091204-369
Human Orthologues:
C20orf117, C6orf174, KIAA0802, RP3-403A15.5
Human Descriptions:
C6orf174 protein [Source:UniProtKB/TrEMBL;Acc:A5PLQ8]
KIAA0802 [Source:HGNC Symbol;Acc:29121]
chromosome 20 open reading frame 117 [Source:HGNC Symbol;Acc:16111]
chromosome 6 open reading frame 174 [Source:HGNC Symbol;Acc:21494]
Mouse Orthologues:
1110012J17Rik, 6330407J23Rik, 9830001H06Rik
Mouse Descriptions:
RIKEN cDNA 1110012J17 gene Gene [Source:MGI Symbol;Acc:MGI:1915867]
RIKEN cDNA 6330407J23 gene Gene [Source:MGI Symbol;Acc:MGI:1914662]
RIKEN cDNA 9830001H06 gene Gene [Source:MGI Symbol;Acc:MGI:2444575]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44020 Nonsense Mutation detected in F1 DNA Not yet available
sa29961 Nonsense Mutation detected in F1 DNA Not yet available
sa29962 Nonsense Mutation detected in F1 DNA Not yet available
sa10465 Nonsense Available for shipment Available now
sa6745 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44020
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 None None 744 None 15
ENSDART00000142953 None None 545 None 4
ENSDART00000144485 Nonsense 234 523 4 4
Genomic Location (Zv9):
Chromosome 23 (position 31219148)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31054038
GRCz11 23 30980569
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTTCACTTGCGACTGGTGGAAGAGGAAGCCACGCTGCTGAGTCGT[C/T]GAATTGTGGAGCTGGAGGTGGAGAACCGTGGGTTGCGGGCAGAGATGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29961
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 48 744 2 15
ENSDART00000142953 None None 545 None 4
ENSDART00000144485 None None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31221389)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31056279
GRCz11 23 30982810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTATTGTCAGAATGATCTTCACCTCTTAAAGGACACAGCGTGCAAGTA[C/A]AACCTGCAAGAGAAGTGCAACAGTCAGGTATGGAAAAGGAGGATGCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 249 744 9 15
ENSDART00000142953 None None 545 None 4
ENSDART00000144485 None None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31227768)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31062658
GRCz11 23 30989189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTTTCCTTTACAGTAAATGGGGGAGAGAGAGAACTGAGGAAGCAGGAT[T/A]GAGAAGAACAAATGAATTATTTTAGATATTATGTTCTATTTTTGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 Nonsense 310 744 12 15
ENSDART00000142953 Nonsense 125 545 3 4
ENSDART00000144485 None None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31230610)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31065500
GRCz11 23 30992031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AASCCAACAAGAACTGGAAGTACMTCAGTCATGAAGCTGCCCTTCTTGAC[C/T]RAGAGGACGCCTGCAAGACTTGGGACTGTCCTATCATGCCTCCCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6745
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115417 None None 744 None 15
ENSDART00000142953 Nonsense 464 545 3 4
ENSDART00000144485 None None 523 None 4
Genomic Location (Zv9):
Chromosome 23 (position 31231627)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31066517
GRCz11 23 30993048
KASP Assay ID:
554-4794.1 (used for ordering genotyping assays)
KASP Sequence:
GCGGTCGAGGAGAGAARACCAACRTAGAGATGGAGAAAGCGCCAGTGGCT[C/T]GAAGGGATCATGTTAGTCTGGCGGCGGGTTCAAAGAAATCTGAACACCCY
Associated Phenotype:
Not determined