Busch Lab

ZMP

si:dkey-253d23.12

Ensembl ID:
ENSDARG00000078234
ZFIN ID:
ZDB-GENE-070912-478
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S6L3]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa37433 Nonsense Mutation detected in F1 DNA Not yet available
sa29724 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa45754 Nonsense Mutation detected in F1 DNA Not yet available
sa3172 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37433
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 None None 887 None 11
ENSDART00000146598 Nonsense 151 790 5 7
Genomic Location (Zv9):
Chromosome 22 (position 10078496)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9938664
GRCz11 22 9968346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTCACAGGAAACACAAGGGGTTTCAAGACGGTCTTCTGGGGATCTTT[C/T]AGGTATAAGTAAAAGACATACATTTGTTGTAATTTTTGTGTTAAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19279
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Nonsense 88 887 1 11
ENSDART00000146598 Nonsense 379 790 7 7
Genomic Location (Zv9):
Chromosome 22 (position 10077294)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9937462
GRCz11 22 9967144
KASP Assay ID:
2261-6438.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTCAGTTTTTCCCGGAGACAAAAGGACTGAACCTTACAAGAAGGAAT[C/T]GATTCAAAGTCCTGTTCATCCTTGATGGATTGGATGAATGTCGTCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Missense 249 887 2 11
ENSDART00000146598 Nonsense 559 790 7 7
Genomic Location (Zv9):
Chromosome 22 (position 10076754)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9936922
GRCz11 22 9966604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACACAGATGTACACACACTTTCTGCGCTTTCAGATCCAGCAGAGCAGA[C/T]GAAAGTATAATGGAGAATACACACCAGATGTGTCCTGGGATAAAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Nonsense 489 887 4 11
ENSDART00000146598 None None 789 None 7
Genomic Location (Zv9):
Chromosome 22 (position 10075977)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9936145
GRCz11 22 9965827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAATTCCATAAATCAGACGAGTGTCTCATCAGACTATCAGCAGTCATC[A/T]AAACCTGCAAAAGAGCTCTGTAAGTCCATGAATACAAAGTAAAATTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4985
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Nonsense 659 887 8 11
ENSDART00000146598 None None 790 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10065439)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9925607
GRCz11 22 9955289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTAACATGAATCTCAGTCATTGTCCTTYCTGTCTTCAGTTTGTGTTA[T/G]TGCAGTATTACAGAGGAACGGTGTGAGATCCTGACTTCAGCTCTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3172
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Essential Splice Site 714 887 9 11
ENSDART00000146598 None None 790 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10064900)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9925068
GRCz11 22 9954750
KASP Assay ID:
554-2870.1 (used for ordering genotyping assays)
KASP Sequence:
CTGACATATCAACATGTATCTCAGTCATTGTCTTTTCGCTTTCTATCTTC[A/T]GACTTTGTAAATGCAGTATTACAGAGGAACAGTGTGTGATCCTGACTTCA
Associated Phenotype:
Not determined