Busch Lab

ZMP

si:ch211-204d2.4

Ensembl ID:
ENSDARG00000078221
ZFIN ID:
ZDB-GENE-081105-163
Description:
pleckstrin homology domain-containing family A member 2 [Source:RefSeq peptide;Acc:NP_001121835]
Human Orthologue:
PLEKHA2
Human Description:
pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 [Source
Mouse Orthologue:
Plekha2
Mouse Description:
pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 Gene [S

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34317 Nonsense Available for shipment Available now
sa21208 Essential Splice Site Available for shipment Available now
sa34318 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Nonsense 60 391 2 11
ENSDART00000133532 Nonsense 60 391 3 12
Genomic Location (Zv9):
Chromosome 8 (position 11539439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11129685
GRCz11 8 11167390
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTAAAAAACAGAACCTACCTGTTGGAACGGAGCATGTTGGAAGTTTA[C/T]GACTCAGTTACATTTCAAAGGTTTGGTGCTGGCGTGTAACAATGACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Essential Splice Site 66 391 2 11
ENSDART00000133532 Essential Splice Site 66 391 3 12
Genomic Location (Zv9):
Chromosome 8 (position 11539460)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11129664
GRCz11 8 11167369
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGGAACGGAGCATGTTGGAAGTTTACGACTCAGTTACATTTCAAAG[G/A]TTTGGTGCTGGCGTGTAACAATGACTATATACTGCATTTTTATTACTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34318
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113407 Nonsense 212 391 7 11
ENSDART00000133532 Nonsense 212 391 8 12
Genomic Location (Zv9):
Chromosome 8 (position 11548122)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11121002
GRCz11 8 11158707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTTCAGAGGAAAAGCTGGAAGAGGAGATTTTTTATTTTGGATGAC[C/T]AAACTGTGAGCTACTACAAATCTGAAATGGTGAGATGCTGGAAAGGTGAA
Associated Phenotype:
Not determined