Busch Lab

ZMP

si:ch73-22b20.2

Ensembl ID:
ENSDARG00000078216
ZFIN ID:
ZDB-GENE-081104-264
Description:
Novel protein similar to H.sapiens EPS15, epidermal growth factor receptor pathway substrate 15 (EPS
Human Orthologue:
EPS15
Human Description:
epidermal growth factor receptor pathway substrate 15 [Source:HGNC Symbol;Acc:3419]
Mouse Orthologue:
Eps15
Mouse Description:
epidermal growth factor receptor pathway substrate 15 Gene [Source:MGI Symbol;Acc:MGI:104583]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34359 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34359
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098692 Essential Splice Site 404 1039 13 26
ENSDART00000124257 Essential Splice Site 404 1024 13 24
Genomic Location (Zv9):
Chromosome 8 (position 17057784)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16502672
GRCz11 8 16538384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCAAAGACAGGGAGGAAACTATTCGACAAAGGACCAGCGAAGTCCAGG[T/C]AAGAACCCATTCATATTTTAATGCAAATAAACGTATTTTGATTTAGCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27158
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098692 Nonsense 740 1039 20 26
ENSDART00000124257 Nonsense 725 1024 19 24
Genomic Location (Zv9):
Chromosome 8 (position 17044912)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16489800
GRCz11 8 16525512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACAACTGTTGTTTTGCTATCCAGATCCTTTCGGCGGGGATCCTTTT[A/T]AAGGCACAGACCCATTTGCAGCAGACAACTTTTTCAAGCAGTCTTCTGGC
Associated Phenotype:
Not determined