Busch Lab

ZMP

si:ch211-67e16.3

Ensembl ID:
ENSDARG00000078193
ZFIN ID:
ZDB-GENE-070912-310
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRX3]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12843 Essential Splice Site Available for shipment Available now
sa41378 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5528
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110348 Nonsense 110 242 2 6
ENSDART00000143837 Nonsense 108 240 2 5

The following transcripts of ENSDARG00000078193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14290501)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14043066
GRCz11 9 14014269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGAACAATCCCAAAGACATACACAATTCTACATTTTCCTGTGAGATAW[C/A]GAAAATTAAACCATTCCCTGTCGAAACAATGACAGGGCCTGAAGCTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12843
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110348 Essential Splice Site 188 242 3 6
ENSDART00000143837 Essential Splice Site 186 240 3 5

The following transcripts of ENSDARG00000078193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14290843)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14043408
GRCz11 9 14014611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTCTTTCTACAGCATCATTGTAACTGTGACCTACATCAGATTGAGGG[T/C]AAAGCATTTWCAGAATTTTTATTGCCTGTGTCNNNNTGTTGGGTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110348 Nonsense 222 242 5 6
ENSDART00000143837 Nonsense 220 240 5 5

The following transcripts of ENSDARG00000078193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14295400)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14047965
GRCz11 9 14019168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAATGTAAAGCGGCATGATATTGACAACACAGAATACGTGGACATGCGT[G/T]AATTGCTGAAACGAGGAGGATCCCACAGAGATATGAACCACAACTCTCAT
Associated Phenotype:
Not determined