Busch Lab

ZMP

PTGFRN (1 of 2)

Ensembl ID:
ENSDARG00000078172
Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Human Orthologue:
PTGFRN
Human Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologue:
Ptgfrn
Mouse Description:
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34536 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112635 Nonsense 78 466 1 6
Genomic Location (Zv9):
Chromosome 9 (position 494812)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 511282
GRCz11 9 510915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGTGCTCTGACCGCAGGAGCGCAGTATCAGCAGAGATTGGATCGC[G/T]GAGACATCGCTCTGACCAGAACACCAGACAACACCTTCATGCTGCGGATC
Associated Phenotype:
Not determined