Busch Lab

ZMP

si:dkeyp-22h2.2

Ensembl ID:
ENSDARG00000078163
ZFIN ID:
ZDB-GENE-090313-378
Description:
Novel protein similar to H.sapiens HPSE2, heparanase 2 (HPSE2) [Source:UniProtKB/TrEMBL;Acc:B8A4P9]
Human Orthologue:
HPSE2
Human Description:
heparanase 2 [Source:HGNC Symbol;Acc:18374]
Mouse Orthologue:
Hpse2
Mouse Description:
heparanase 2 Gene [Source:MGI Symbol;Acc:MGI:2685814]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3841
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114985 Nonsense 248 593 6 14
ENSDART00000137310 None None 257 None 6
ENSDART00000139873 Nonsense 190 279 4 6
Genomic Location (Zv9):
Chromosome 13 (position 41173297)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40439005
GRCz11 13 40564895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGAAACCCAGACAACTCGTGGAATGCAACCAGTGCTCTGAGTCTGCTC[A/T]AATACAGCGCCGGCAAAAAATACAACATCTCCTGGGAGCTCGGCAATGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2715
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114985 Nonsense 444 593 12 14
ENSDART00000137310 Nonsense 108 257 4 6
ENSDART00000139873 None None 279 None 6
Genomic Location (Zv9):
Chromosome 13 (position 41247907)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40509959
GRCz11 13 40635849
KASP Assay ID:
554-3348.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTTATATATTTTCTGACATGTGTTTTGTGTGTTTGCTTTGTAGGATTA[T/G]TGGGTATCTCTGCTCTTCAAACATCTGGTGGGCCCGAGGGTGCTGGCGGT
Associated Phenotype:
Not determined