Busch Lab

ZMP

si:ch211-264f5.8

Ensembl ID:
ENSDARG00000078151
ZFIN ID:
ZDB-GENE-081104-209
Human Orthologue:
GRIK5
Human Description:
glutamate receptor, ionotropic, kainate 5 [Source:HGNC Symbol;Acc:4583]
Mouse Orthologue:
Grik5
Mouse Description:
glutamate receptor, ionotropic, kainate 5 (gamma 2) Gene [Source:MGI Symbol;Acc:MGI:95818]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43211 Nonsense Mutation detected in F1 DNA Not yet available
sa23431 Nonsense Available for shipment Available now
sa23430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43211
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 421 979 10 18
ENSDART00000134340 None None 413 None 5
Genomic Location (Zv9):
Chromosome 19 (position 6446085)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5904850
GRCz11 19 5823064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGAGAACTACCAGGACTTTCAGGGTAGCGATCAGTACGAGGGCTTCTG[T/A]GTGGATATGCTGCGAGAGCTGGCAGACATACTCAAGTTTTCCTTCCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 544 979 13 18
ENSDART00000134340 None None 413 None 5
Genomic Location (Zv9):
Chromosome 19 (position 6435346)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5894111
GRCz11 19 5812131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTATTTGTTTGTGTGTTTGGCGTCTGCTATCAGGCTGAGTCCTTA[T/G]GAGTGGTACAACCCATTCCCGTGTTGGCGGGAGCGCAGGGACCTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29146
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Essential Splice Site 598 979 13 18
ENSDART00000134340 None None 413 None 5
Genomic Location (Zv9):
Chromosome 19 (position 6435183)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5893948
GRCz11 19 5811968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGATCATGCCACGGGCTCTGTCCACACGCTGCGTCAGTGGCGTCTGG[T/G]AAGTGTGACGATCTTTCACACCTTTTATGAGGTGCTTATCTGCGAGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29145
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Essential Splice Site 729 979 15 18
ENSDART00000134340 Essential Splice Site 132 413 2 5
Genomic Location (Zv9):
Chromosome 19 (position 6424006)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5882861
GRCz11 19 5801113
KASP Assay ID:
2261-2876.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGGAGGCCTGCTGGACACCAAGGGCTACGGCATCGGCATGCCTTTGGG[T/C]GAGTATGCTTTATAATATGCTGAGTACTAGTGATGGGTCCTTCTTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 803 979 17 18
ENSDART00000134340 Nonsense 205 413 4 5
Genomic Location (Zv9):
Chromosome 19 (position 6408415)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5867270
GRCz11 19 5785522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTGGGCTCATAATCGCTGTTTTTGTAGCCATTATGGAGTTTGTGTG[G/A]TCCACGCGCCGGTCGGCGGAGACAGATGAGGTACGCCCTCACCCCTGCCC
Associated Phenotype:
Not determined