Busch Lab

ZMP

si:ch211-218g4.2

Ensembl ID:
ENSDARG00000078145
ZFIN ID:
ZDB-GENE-090312-60
Human Orthologue:
ARHGAP39
Human Description:
Rho GTPase activating protein 39 [Source:HGNC Symbol;Acc:29351]
Mouse Orthologue:
Arhgap39
Mouse Description:
Rho GTPase activating protein 39 Gene [Source:MGI Symbol;Acc:MGI:107858]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32433 Nonsense Available for shipment Available now
sa43929 Nonsense Mutation detected in F1 DNA Not yet available
sa37648 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32433
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082060 Nonsense 21 1060 2 10
ENSDART00000133624 None None 898 None 9
Genomic Location (Zv9):
Chromosome 23 (position 15232511)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15365390
GRCz11 23 15121467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTCTGACTGGGTGGAGATCGTGGAGCCGCGCTCGAGGGAGCGCATGTA[T/A]GTTAACCTGCTGACCGGCGAGTGTGGTTGGGAACCACCGCCTGGCGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082060 Nonsense 254 1060 3 10
ENSDART00000133624 Nonsense 92 898 2 9
Genomic Location (Zv9):
Chromosome 23 (position 15198972)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15331851
GRCz11 23 15087928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCACCAGCGCTCTGGTGCAGGTACACCTCGCCCCTCTTCCCCTCAGTA[T/A]GGGGCTACACCCTCAGCACCCATCTATGATGAACCTCCAGCACTGGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37648
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082060 Nonsense 967 1060 9 10
ENSDART00000133624 Nonsense 805 898 8 9
Genomic Location (Zv9):
Chromosome 23 (position 15159882)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15292761
GRCz11 23 15048838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGCCGGTGATCCCACAGAGCTTCTATAAGCAGTGCATCAGTCATTA[T/A]GAAGATCCAGACGCAGCTGTCAATGTGGTTCAATCTCTGCCAGAGCTCAA
Associated Phenotype:
Not determined