Busch Lab

ZMP

LOC562570

Ensembl ID:
ENSDARG00000078141
Mouse Orthologue:
Elfn1
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 1 Gene [Source:MGI Symbol;Acc:MGI:244247

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa6913 Nonsense Mutation detected in F1 DNA Not yet available
sa14448 Nonsense Available for shipment Available now
sa13873 Nonsense Available for shipment Available now
sa14082 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3449
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 223 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43997207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46056781
GRCz11 3 42547979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGACAAGTGAGCGGATGGTATGTGACTCTCCTGCAGGGGTCTCAGGCTA[C/A]AGTCTTCTAAGCCAGAATCCGRCCAATCCCACATACCGGAATGCTCTGCA
Long Flanking Sequence:
ACCATAGTGGACCTTCGCTTGAATGAGAACAAGATCAAGAGTATCCACTACTCTGCCCTCAGCCGCTTTACCAACCTCACATACCTGAATCTGACCAAGAATGAGATTAATTACATCGAGGATGGAGCTTTTTCGGCCCAGTTTAATTTGCAGGTTCTCCAGTTAGGCTTCAATAAGATGCGTAACTTGACTGAAGGGATTCTCAGGGGATTGGGCAAGCTGCAGTACCTCTACCTCCAGGCCAACCTGATTGAGACTGTGACACCCAATGCCTTTTGGGAGTGCCCAAACATTGAAAACATTGACCTTTCTATGAACCGCCTCCAGGTGTTAGATGGGTCTACCTTCACCAGCCTGACTAAGTTGACCACCTGTGAACTCTACACAAACCCTTTCAACTGCTCCTGTGAGCTCTTGGGGTTTGTAAAGTGGCTGTCTGTCTTTCCCAACCGGACAAGTGAGCGGATGGTATGTGACTCTCCTGCAGGGGTCTCAGGCTA[C/A]AGTCTTCTAAGCCAGAATCCGACCAATCCCACATACCGGAATGCTCTGCATATGCTGTCCACTGTGTGCACGGAGGATTATGTGACTCCGTATATATCTGTGCCTCCTGATACCACCACTTTCCCTCCGGACTCCACACCATGTGGGCTTGAAGACTGTCCCTCAGGTACTGAGCCGGAGGAAATCAGCATAAGTCCCACGTTCCTAGATTTAGATGTGAAACCAATCATGAAACTCAAACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCCTACAAGAAAATGTACATCCTTGTGTTGTACAACAACAGCTTCTTCACTGATATACAGAATCTGAAGCGACAGAAAGAGGACATTGAACTAAAAAACCTGAAACCCCACACTGATTACACCTACTGTGTGGCTTCAATAAGAAACTCATTGCGATTCAATCATACTTGCCTGACACTATCTACTGGGCCTAAGAATGGAAAAGAGCGAGTAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8142
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 297 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43997427)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46056561
GRCz11 3 42547759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCCGGAGGAAATCAGCATAAGTCCCRCGTTCCTAGATTTAGATGTG[A/T]AACCAATCATGAAACTYWAACAAGTGTCTCACACGAACGCAGTAATCACT
Long Flanking Sequence:
TGCAGTACCTCTACCTCCAGGCCAACCTGATTGAGACTGTGACACCCAATGCCTTTTGGGAGTGCCCAAACATTGAAAACATTGACCTTTCTATGAACCGCCTCCAGGTGTTAGATGGGTCTACCTTCACCAGCCTGACTAAGTTGACCACCTGTGAACTCTACACAAACCCTTTCAACTGCTCCTGTGAGCTCTTGGGGTTTGTAAAGTGGCTGTCTGTCTTTCCCAACCGGACAAGTGAGCGGATGGTATGTGACTCTCCTGCAGGGGTCTCAGGCTACAGTCTTCTAAGCCAGAATCCGACCAATCCCACATACCGGAATGCTCTGCATATGCTGTCCACTGTGTGCACGGAGGATTATGTGACTCCGTATATATCTGTGCCTCCTGATACCACCACTTTCCCTCCGGACTCCACACCATGTGGGCTTGAAGACTGTCCCTCAGGTACTGAGCCGGAGGAAATCAGCATAAGTCCCACGTTCCTAGATTTAGATGTG[A/T]AACCAATCATGAAACTCAAACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCCTACAAGAAAATGTACATCCTTGTGTTGTACAACAACAGCTTCTTCACTGATATACAGAATCTGAAGCGACAGAAAGAGGACATTGAACTAAAAAACCTGAAACCCCACACTGATTACACCTACTGTGTGGCTTCAATAAGAAACTCATTGCGATTCAATCATACTTGCCTGACACTATCTACTGGGCCTAAGAATGGAAAAGAGCGAGTAGCAAGTAATGCAACTGCCACTCACTACATAATGACTATTTTAGGATGTCTTTTCAGTATGGTAATCGTTTTAGGCATTGTGTATTATTGTTTGCGGAAAAAGAGGCAACAAGATGAAAAGCACAAAAAGGCAGGCAGCCTAAAGAAGAACATAATCGAGCTTAAATATGGGGGTGAGCTGGAAGGTGGGACAATATCAAGGATGTCTCAAAAGCAAATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6913
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 303 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43997445)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46056543
GRCz11 3 42547741
KASP Assay ID:
554-4815.1 (used for ordering genotyping assays)
KASP Sequence:
GCATAAGTCCCRCGTTCCTAGATTTAGATGTGWAACCAATCATGAAACTY[A/T]AACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCC
Long Flanking Sequence:
AGGCCAACCTGATTGAGACTGTGACACCCAATGCCTTTTGGGAGTGCCCAAACATTGAAAACATTGACCTTTCTATGAACCGCCTCCAGGTGTTAGATGGGTCTACCTTCACCAGCCTGACTAAGTTGACCACCTGTGAACTCTACACAAACCCTTTCAACTGCTCCTGTGAGCTCTTGGGGTTTGTAAAGTGGCTGTCTGTCTTTCCCAACCGGACAAGTGAGCGGATGGTATGTGACTCTCCTGCAGGGGTCTCAGGCTACAGTCTTCTAAGCCAGAATCCGACCAATCCCACATACCGGAATGCTCTGCATATGCTGTCCACTGTGTGCACGGAGGATTATGTGACTCCGTATATATCTGTGCCTCCTGATACCACCACTTTCCCTCCGGACTCCACACCATGTGGGCTTGAAGACTGTCCCTCAGGTACTGAGCCGGAGGAAATCAGCATAAGTCCCACGTTCCTAGATTTAGATGTGAAACCAATCATGAAACTC[A/T]AACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCCTACAAGAAAATGTACATCCTTGTGTTGTACAACAACAGCTTCTTCACTGATATACAGAATCTGAAGCGACAGAAAGAGGACATTGAACTAAAAAACCTGAAACCCCACACTGATTACACCTACTGTGTGGCTTCAATAAGAAACTCATTGCGATTCAATCATACTTGCCTGACACTATCTACTGGGCCTAAGAATGGAAAAGAGCGAGTAGCAAGTAATGCAACTGCCACTCACTACATAATGACTATTTTAGGATGTCTTTTCAGTATGGTAATCGTTTTAGGCATTGTGTATTATTGTTTGCGGAAAAAGAGGCAACAAGATGAAAAGCACAAAAAGGCAGGCAGCCTAAAGAAGAACATAATCGAGCTTAAATATGGGGGTGAGCTGGAAGGTGGGACAATATCAAGGATGTCTCAAAAGCAAATGATGGCTGGGGAGAGCATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 418 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43997792)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46056196
GRCz11 3 42547394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTTAGGATGTCTTTTCAGTATKGTAATCRTTTTAGGCATTGTGTATTA[T/G]TGTTTGCGGAAAAAGAGGCAACAAGATGAAAAGCACAAAAAGGCAGGCAG
Long Flanking Sequence:
ACTCCGTATATATCTGTGCCTCCTGATACCACCACTTTCCCTCCGGACTCCACACCATGTGGGCTTGAAGACTGTCCCTCAGGTACTGAGCCGGAGGAAATCAGCATAAGTCCCACGTTCCTAGATTTAGATGTGAAACCAATCATGAAACTCAAACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCCTACAAGAAAATGTACATCCTTGTGTTGTACAACAACAGCTTCTTCACTGATATACAGAATCTGAAGCGACAGAAAGAGGACATTGAACTAAAAAACCTGAAACCCCACACTGATTACACCTACTGTGTGGCTTCAATAAGAAACTCATTGCGATTCAATCATACTTGCCTGACACTATCTACTGGGCCTAAGAATGGAAAAGAGCGAGTAGCAAGTAATGCAACTGCCACTCACTACATAATGACTATTTTAGGATGTCTTTTCAGTATGGTAATCGTTTTAGGCATTGTGTATTA[T/G]TGTTTGCGGAAAAAGAGGCAACAAGATGAAAAGCACAAAAAGGCAGGCAGCCTAAAGAAGAACATAATCGAGCTTAAATATGGGGGTGAGCTGGAAGGTGGGACAATATCAAGGATGTCTCAAAAGCAAATGATGGCTGGGGAGAGCATGACTCGGATGCCCTACCTACCGTCCGGCAGTGAAATGGAACAATACAAACTGCAAGACATCAGCGACACACCGAAAATGGCCAAAGGGAATTATATGGAAGTGAGAACAGGGGAGCATCCGGATCGAAGGGATTGTGAGATGTCCATGGCTGGCAATAGCCAAGGTTCGGTTGCAGAGATCTCGACAATTGCAAAAGAAGTGGACAAGGTCAACCAGATTATTAATAATTGTATTGATGCTCTAAAATCAGAATCCACATCCTTCCAAGGGGTGAAGTCTGGTGCGGTGTCAACTGCTGAACCTCAGTTGGTACTCATTTCAGAGCAGCCTCAGAGCAAGTCTGGCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13873
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 624 784 1 1
ENSDART00000111535 Nonsense 624 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43998410)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46055578
GRCz11 3 42546776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACGTCCCAGTACAGCTACTGGAGRTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGARTCAAAGTACATAGAGAAGACTTC
Long Flanking Sequence:
TCTCAAAAGCAAATGATGGCTGGGGAGAGCATGACTCGGATGCCCTACCTACCGTCCGGCAGTGAAATGGAACAATACAAACTGCAAGACATCAGCGACACACCGAAAATGGCCAAAGGGAATTATATGGAAGTGAGAACAGGGGAGCATCCGGATCGAAGGGATTGTGAGATGTCCATGGCTGGCAATAGCCAAGGTTCGGTTGCAGAGATCTCGACAATTGCAAAAGAAGTGGACAAGGTCAACCAGATTATTAATAATTGTATTGATGCTCTAAAATCAGAATCCACATCCTTCCAAGGGGTGAAGTCTGGTGCGGTGTCAACTGCTGAACCTCAGTTGGTACTCATTTCAGAGCAGCCTCAGAGCAAGTCTGGCTTCCTCTCACCTGTCTACAAGGACAGCTACCACCACTCTTTACAAAGACATCATGCATCAGACGCCTCTCCGAAACGTCCCAGTACAGCTACTGGAGGTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGAATCAAAGTACATAGAGAAGACTTCACCCACAGGAGAGACTATCCTGACCATCACGCCTGCAGCTGCAATACTAAGGGCAGAGGCGGAAAAGATCCGCCAGTATAGTGAGCATCGGCATTCTTACCCTGATGCCCACCAAATTGAGGAGCTGGAAGGACCAGAAAGCCGGAAAACCTCTATCTTAGAGCCTCTGACTCGGCCTCGGGCAAGAGACTTGGCTTACTCACAACTCTCTCCCCAGTATCACAATCTCAGTTACTCGTCTAGTCCTGAGTACTACTGCAAACCATCACACAGCATCTGGGAGCGCTTTAAACTCCATCGCAAGCGACACAAAGACGAGGAGTACATGGCTGCGGGCCACGCTCTAAGGAAAAAAGTGCAGTTTGCAAAGGATGAAGACCTGCATGACATTCTAGATTACTGGAAGGGAGTATCGGCCCAACAAAAATCTTAATCTTCTCAAGTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14082
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 624 784 1 1
ENSDART00000111535 Nonsense 624 784 1 1
Genomic Location (Zv9):
Chromosome 3 (position 43998410)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 46055578
GRCz11 3 42546776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACGTCCCAGTACAGCTACTGGAGRTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGARTCAAAGTACATAGAGAAGACTTC
Long Flanking Sequence:
TCTCAAAAGCAAATGATGGCTGGGGAGAGCATGACTCGGATGCCCTACCTACCGTCCGGCAGTGAAATGGAACAATACAAACTGCAAGACATCAGCGACACACCGAAAATGGCCAAAGGGAATTATATGGAAGTGAGAACAGGGGAGCATCCGGATCGAAGGGATTGTGAGATGTCCATGGCTGGCAATAGCCAAGGTTCGGTTGCAGAGATCTCGACAATTGCAAAAGAAGTGGACAAGGTCAACCAGATTATTAATAATTGTATTGATGCTCTAAAATCAGAATCCACATCCTTCCAAGGGGTGAAGTCTGGTGCGGTGTCAACTGCTGAACCTCAGTTGGTACTCATTTCAGAGCAGCCTCAGAGCAAGTCTGGCTTCCTCTCACCTGTCTACAAGGACAGCTACCACCACTCTTTACAAAGACATCATGCATCAGACGCCTCTCCGAAACGTCCCAGTACAGCTACTGGAGGTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGAATCAAAGTACATAGAGAAGACTTCACCCACAGGAGAGACTATCCTGACCATCACGCCTGCAGCTGCAATACTAAGGGCAGAGGCGGAAAAGATCCGCCAGTATAGTGAGCATCGGCATTCTTACCCTGATGCCCACCAAATTGAGGAGCTGGAAGGACCAGAAAGCCGGAAAACCTCTATCTTAGAGCCTCTGACTCGGCCTCGGGCAAGAGACTTGGCTTACTCACAACTCTCTCCCCAGTATCACAATCTCAGTTACTCGTCTAGTCCTGAGTACTACTGCAAACCATCACACAGCATCTGGGAGCGCTTTAAACTCCATCGCAAGCGACACAAAGACGAGGAGTACATGGCTGCGGGCCACGCTCTAAGGAAAAAAGTGCAGTTTGCAAAGGATGAAGACCTGCATGACATTCTAGATTACTGGAAGGGAGTATCGGCCCAACAAAAATCTTAATCTTCTCAAGTGTTTGT
Associated Phenotype:
Not determined