Busch Lab

ZMP

ENSDARG00000078133

Ensembl ID:
ENSDARG00000078133
Human Orthologues:
FBXL19, KDM2A, KDM2B
Human Descriptions:
F-box and leucine-rich repeat protein 19 [Source:HGNC Symbol;Acc:25300]
lysine (K)-specific demethylase 2A [Source:HGNC Symbol;Acc:13606]
lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610]
Mouse Orthologues:
Fbxl19, Kdm2a, Kdm2b
Mouse Descriptions:
F-box and leucine-rich repeat protein 19 Gene [Source:MGI Symbol;Acc:MGI:3039600]
lysine (K)-specific demethylase 2A Gene [Source:MGI Symbol;Acc:MGI:1354736]
lysine (K)-specific demethylase 2B Gene [Source:MGI Symbol;Acc:MGI:1354737]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35681 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28299 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1479 Nonsense Available for shipment Available now
sa42387 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Essential Splice Site 12 1275 1 28
Genomic Location (Zv9):
Chromosome 14 (position 22756797)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21458285
GRCz11 14 21755530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTTTCAGAGTATGTCAGAGGCTAAATCCCGTTATAGCAAACGACTGG[T/G]AAGTTTCTCATTTACTCAACAGCTTTTATCCAAACCAAATTGCTGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28299
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Essential Splice Site 85 1275 4 28
Genomic Location (Zv9):
Chromosome 14 (position 22760745)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21462233
GRCz11 14 21759478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATTGCCTATTTTTTGTGTGTGCGTGTCTTTTTCTTTTCTTTTTTGT[A/T]GGATGCCTGACCCAGACTTTAGCGTCAGTGATGTGAAATTATTTGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 268 1275 8 28
Genomic Location (Zv9):
Chromosome 14 (position 22763031)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21464519
GRCz11 14 21761764
KASP Assay ID:
554-1404.1 (used for ordering genotyping assays)
KASP Sequence:
AGGCGACATCTTTCTTGGGGATAAAGCCTCTATGTGCCAACGGATTGAAT[T/A]GAAACAAGGCTACACCTTTATGATCCCCTCAGGTATGCACATWCTGCAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42387
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 887 1275 23 28
Genomic Location (Zv9):
Chromosome 14 (position 22773797)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21475285
GRCz11 14 21772530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCAGGAGTCTTGCGTCACGGTCAAGTTACAACCATCAAGAGCTAAA[C/T]GAGATCCTAGCACCATCGTTCCCAAATTGGAAGCCAACTTGTCTTCAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2775
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 1101 1275 25 28
ENSDART00000111839 Nonsense 1101 1275 25 28
Genomic Location (Zv9):
Chromosome 14 (position 22775605)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21477093
GRCz11 14 21774338
KASP Assay ID:
2260-7479.1 (used for ordering genotyping assays)
KASP Sequence:
GGCAGCTTTCTCACAGGCCTTAAAGATCTGGTGCTATCAGGGTGTAACTG[G/A]TCGTCAGTTTCAGCATTGAGCTCTCCAAGCTGCCCTTTACTGCGCTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19081
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 1101 1275 25 28
ENSDART00000111839 Nonsense 1101 1275 25 28
Genomic Location (Zv9):
Chromosome 14 (position 22775605)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21477093
GRCz11 14 21774338
KASP Assay ID:
2260-7479.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTTTCTCACAGGCCTTAAAGATCTGGTGCTATCAGGGTGTAACTG[G/A]TCGTCAGTTTCAGCATTGAGCTCTCCAAGCTGCCCTTTACTGCGCTCTTT
Associated Phenotype:
Not determined