Busch Lab

ZMP

si:dkey-85k15.9

Ensembl ID:
ENSDARG00000078125
ZFIN ID:
ZDB-GENE-100922-274
Human Orthologue:
RUSC1
Human Description:
RUN and SH3 domain containing 1 [Source:HGNC Symbol;Acc:17153]
Mouse Orthologue:
Rusc1
Mouse Description:
RUN and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919546]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22783 Nonsense Available for shipment Available now
sa36068 Nonsense Mutation detected in F1 DNA Not yet available
sa42685 Nonsense Mutation detected in F1 DNA Not yet available
sa25009 Nonsense Mutation detected in F1 DNA Not yet available
sa36069 Nonsense Mutation detected in F1 DNA Not yet available
sa42686 Nonsense Mutation detected in F1 DNA Not yet available
sa8715 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22783
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 173 1877 1 10
ENSDART00000132075 None None 285 None 8
ENSDART00000135844 None None 244 None 8
ENSDART00000146165 None None 610 None 9
Genomic Location (Zv9):
Chromosome 16 (position 15791984)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14136876
GRCz11 16 14026996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCAAAACAAGAAACTGAAGACGATAAGTGTGAGCCAGAAGTAAAA[C/T]AACCTGATGACTTACCTTTCCCAGTGGAGGAGAAAGAGGAGGAAAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 829 1877 1 10
ENSDART00000132075 None None 285 None 8
ENSDART00000135844 None None 244 None 8
ENSDART00000146165 None None 610 None 9
Genomic Location (Zv9):
Chromosome 16 (position 15793952)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14138844
GRCz11 16 14028964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCCATCTCAAGCCATGCACTCTACCTGCCAATGCATCACGACCTGAT[C/T]GATTTGATTGGCTGATAGCCTTTACCCCAGATATTGAGCCACCACCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42685
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 1035 1877 2 10
ENSDART00000132075 None None 285 None 8
ENSDART00000135844 None None 244 None 8
ENSDART00000146165 None None 610 None 9
Genomic Location (Zv9):
Chromosome 16 (position 15800315)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14145207
GRCz11 16 14035327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCTTATTACCTGCACTCTGCTTCCCTGTCACAAGCCTCCCAATTTTA[T/A]CACACTGACACTACCAGTGATCACGCCATGTCCTATTATGAGGGTTCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25009
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 1115 1877 2 10
ENSDART00000132075 None None 285 None 8
ENSDART00000135844 None None 244 None 8
ENSDART00000146165 None None 610 None 9
Genomic Location (Zv9):
Chromosome 16 (position 15800554)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14145446
GRCz11 16 14035566
KASP Assay ID:
554-7433.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATTCTCAGTATCACCACTGTTATCATGCTGACAGCTTTCTAGATTCTT[T/G]ATACGTCTGTGGGCATGAGCCTGGTAGTGCAAAAAACAGCTTCTGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36069
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 1360 1877 3 10
ENSDART00000132075 Nonsense 53 285 2 8
ENSDART00000135844 Nonsense 3 244 2 8
ENSDART00000146165 Nonsense 93 610 2 9
Genomic Location (Zv9):
Chromosome 16 (position 15804635)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14149527
GRCz11 16 14039647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCTTTTCTTTTGCCGGATCTGAGCAGAAGAATGGGGCCTGGATGGGA[G/T]AGGATGTGAGGTCCTCAATGAGTGCTGAAGGGCTGTCTTCTGTATGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 1396 1877 4 10
ENSDART00000132075 Nonsense 89 285 3 8
ENSDART00000135844 Nonsense 39 244 3 8
ENSDART00000146165 Nonsense 129 610 3 9
Genomic Location (Zv9):
Chromosome 16 (position 15804836)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14149728
GRCz11 16 14039848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGCTCTTGTCAATTCAGTCAGTGTGGCAGTGGAGGCCATTTTGGCT[C/T]AGTTCAGTTCATCCAGGACTGTTGTTCAGAAGGTATGTGCTGTGCTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114322 Nonsense 1861 1877 10 10
ENSDART00000132075 None None 285 None 8
ENSDART00000135844 None None 244 None 8
ENSDART00000146165 Nonsense 594 610 9 9
Genomic Location (Zv9):
Chromosome 16 (position 15819867)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14164759
GRCz11 16 14054879
KASP Assay ID:
2260-9388.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGCTTGTTCTGTTGGGGGGTGTCGACCACGACTGGATTCGATGTCGC[C/T]AAGGTCACCGAGAGGGCCTTGTWCCCATTGGTTATGCTTCACTTATCATG
Associated Phenotype:
Not determined