Busch Lab

ZMP

SDK2 (2 of 2)

Ensembl ID:
ENSDARG00000078116
Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Human Orthologue:
SDK2
Human Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Mouse Orthologue:
Sdk2
Mouse Description:
sidekick homolog 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2443847]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa20127 Nonsense Available for shipment Available now
sa14658 Nonsense Available for shipment Available now
sa9046 Nonsense Mutation detected in F1 DNA Not yet available
sa25259 Nonsense Mutation detected in F1 DNA Not yet available
sa15654 Nonsense Available for shipment Available now
sa2127 Essential Splice Site F2 line generated Not yet available
sa14263 Essential Splice Site Available for shipment Available now
sa26140 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9315 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20127
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 6 2106 1 44
Genomic Location (Zv9):
Chromosome 3 (position 47784154)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50099131
GRCz11 3 51139120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTAGTTGATGGGATTGTCATTTTCTTTCACCAGGTATGTAATTCCAT[C/A]GCTGGACCGCTCTCATGCAGGCTTCTACAGATGTATTGTCAGGAACAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8145
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 108 2106 3 44
Genomic Location (Zv9):
Chromosome 3 (position 47791834)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50091451
GRCz11 3 51131440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACACTTTAGTGATCCTCTCCRCCGTGGCCCCTGATGCAGGCCGGTATTA[T/A]GCTCAGGCCGTCAACGACAAGAACGGAGAGAACAAGACCAGCCAGCCCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5224
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 719 2106 16 44
Genomic Location (Zv9):
Chromosome 3 (position 47845792)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50037493
GRCz11 3 51077482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCTGATTTCCCTCTCCATCTCACTTCATTAAATCTTCTCTTTTTTTC[A/T]GTGCCTACGGTGCCACCAGGGAACGTCCAGGCGGAGGCTGTCAACTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14658
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 841 2106 18 44
Genomic Location (Zv9):
Chromosome 3 (position 47848469)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50034816
GRCz11 3 51074805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTCCTGTAGGTCACCTGAGCTTTACAGAAATCCTGGACACATCTCTC[A/T]AAGTGAGCTGGAAAGACCCGCCTGAGAAGAATGGCATCCTCAYAGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9046
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 874 2106 19 44
Genomic Location (Zv9):
Chromosome 3 (position 47848650)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50034635
GRCz11 3 51074624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCATTTCTTGGGAGGAATTCAACCGGACAAACACTCGTGTCACGCATTA[C/A]CTGCCGAACATGACGCAGGAATACCGGGTCACCGGTCTGACMGCACTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25259
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1016 2106 22 44
Genomic Location (Zv9):
Chromosome 3 (position 47853196)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50030089
GRCz11 3 51070078
KASP Assay ID:
554-7813.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGAGACAAGTAAATATAGTGGGCACAAGCCCACCCAGTCAACCATCC[A/T]GAAAGATCCAGACCCTACAGGCTCCTCCAGACATCGCCCCAGCCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15654
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1100 2106 23 44
Genomic Location (Zv9):
Chromosome 3 (position 47856288)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50026997
GRCz11 3 51066986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACAGGAGAGAGAGTTTRCCATCGAGGACTTGGAAGAGTGGACAGAATA[T/G]GAAGTTAAARTCCAGGCGTTCAACGGYATCGGACCAGGACCATGGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2127
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1229 2106 26 44
Genomic Location (Zv9):
Chromosome 3 (position 47857638)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50025647
GRCz11 3 51065636
KASP Assay ID:
554-3357.1 (used for ordering genotyping assays)
KASP Sequence:
ATTGAGTCCTACCTRTAGTACATTTACTTTTTTATTATTATTATTTAAAC[A/T]GTACCTGGGCCTCCAGTTGGGATCCTTTTCCCTGAAGTCAGGACCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1429 2106 29 44
Genomic Location (Zv9):
Chromosome 3 (position 47859911)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50023374
GRCz11 3 51063363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAGCGAGTACAGTGAGGAGAGTGAGGCAATCACCACTCTACAGGAYGG[T/C]AGGTTCAATTGTGRAATGCTATTGGGGAACAAGTTCCTGAGGCCTGAGGK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26140
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1589 2106 34 44
Genomic Location (Zv9):
Chromosome 3 (position 47867018)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50016267
GRCz11 3 51056256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGATCCTCCTCCAGTGGAGGCCCAGAATGGGGATATTCAAGGCTATAAG[G/A]TACAACAAACCGGTTCTGTCCTTCAAATGATTCTGTTGTGACTCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1737 2106 37 44
Genomic Location (Zv9):
Chromosome 3 (position 47879325)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50003960
GRCz11 3 51043949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGACGGCGTAACCTACAACTTCCGCATCCGCGCTAAAACTCTTACCTA[T/A]GGAYCAGAGATTGAGGCCAACATCACCACTGGCCCTGGAGAGGGTACTTT
Associated Phenotype:
Not determined