Busch Lab

ZMP

si:dkey-106l3.5

Ensembl ID:
ENSDARG00000078105
ZFIN ID:
ZDB-GENE-091204-356
Human Orthologue:
DEPDC5
Human Description:
DEP domain containing 5 [Source:HGNC Symbol;Acc:18423]
Mouse Orthologue:
Depdc5
Mouse Description:
DEP domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2141101]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa1323 Essential Splice Site Available for shipment Available now
sa41618 Nonsense Mutation detected in F1 DNA Not yet available
sa21700 Nonsense Available for shipment Available now
sa41619 Nonsense Mutation detected in F1 DNA Not yet available
sa9750 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1323
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Essential Splice Site 121 1604 5 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Essential Splice Site 125 1568 5 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16931419)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17261667
GRCz11 10 17219631
KASP Assay ID:
554-1237.1 (used for ordering genotyping assays)
KASP Sequence:
AGATCAGTATATTGGGCGAGGAGACATGTGGCGACTAAAGAAGAGCTTAG[T/C]GAGTAGATAAAGTAGAAATCTGCATCTTTGTTCATTTTTTGTTGACTAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3781
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 244 1604 11 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 248 1568 11 41
ENSDART00000138777 None None 149 None 5
ENSDART00000111088 Nonsense 244 1604 11 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 248 1568 11 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16935042)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17258044
GRCz11 10 17216008
KASP Assay ID:
2260-3069.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTCTTCTTTTAGAGGAGTTTCCAGAGAGCCAAAGAGCATCAGTTCGA[C/T]AAGACCATGAAGGCCGCTATTATGAGGATTTCTACAGGTCAGGAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18982
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 244 1604 11 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 248 1568 11 41
ENSDART00000138777 None None 149 None 5
ENSDART00000111088 Nonsense 244 1604 11 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 248 1568 11 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16935042)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17258044
GRCz11 10 17216008
KASP Assay ID:
2260-3069.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTCTTCTTTTAGAGGAGTTTCCAGAGAGCCAAAGAGCATCAGTTCGA[C/T]AAGACCATGAAGGCCGCTATTATGAGGATTTCTACAGGTCAGGAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27584
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 372 1604 15 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 376 1568 15 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16937288)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17255798
GRCz11 10 17213762
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTATGTTTCTGATAGGCATTGGTGTTGATCTGGTGTGTATGGGAGAA[C/T]AGCCCCTTCACGCTGTTCCACTCTTCAAGGTTAGTGTACTTCACATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41618
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 476 1604 19 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 480 1568 19 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16941371)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17251715
GRCz11 10 17209679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATGCGTATGATTCTCAGGTCTTCAGGCTTCCTGGGCCCTCCAGAGCT[C/T]AGAGGTCCACCAACTTTAGGTACATTAGACAAATGAAAAACATAGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21700
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 922 1604 28 44
ENSDART00000131751 None None 266 None 7
ENSDART00000134059 Nonsense 909 1568 28 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16958874)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17234212
GRCz11 10 17192176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGAGCGGCTGGAGGAGTACAAGTGGAACTATTTAGACCAGTACATCTG[C/A]TCTGCCGGATCAGAGGACTTCAGGTAAGTAGTGTTATTCAGTTCACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41619
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Nonsense 1315 1604 39 44
ENSDART00000131751 Nonsense 70 266 2 7
ENSDART00000134059 Nonsense 1279 1568 36 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16974539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17218547
GRCz11 10 17176511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTATGGAGGAACGTCGACCATGTGACTTACCTGCCTTTCTGCTGCCTT[G/A]GTTGCCCAGCCGGCCAGCCTCGTATGCAAGTAGGCATAGCTCCTTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111088 Essential Splice Site 1459 1604 None 44
ENSDART00000131751 Essential Splice Site 194 266 None 7
ENSDART00000134059 Essential Splice Site 1423 1568 None 41
ENSDART00000138777 None None 149 None 5

The following transcripts of ENSDARG00000078105 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16976898)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17216188
GRCz11 10 17174152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAAATATCCAGTGCCTGCTAAAGGAGGGCTCTGATAACCTTTTTGAGGG[T/C]GAGGACACAAGAAGTAATTGTGCAGTTGTTGTAGTCCAAGGGACAGATTC
Associated Phenotype:
Not determined