Busch Lab

ZMP

LOC556807

Ensembl ID:
ENSDARG00000078088
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa15748 Nonsense Available for shipment Available now
sa40994 Nonsense Mutation detected in F1 DNA Not yet available
sa40993 Nonsense Mutation detected in F1 DNA Not yet available
sa34166 Nonsense Mutation detected in F1 DNA Not yet available
sa40992 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34165 Nonsense Mutation detected in F1 DNA Not yet available
sa15416 Nonsense Available for shipment Available now
sa40991 Nonsense Mutation detected in F1 DNA Not yet available
sa21053 Nonsense Available for shipment Available now
sa27032 Nonsense Mutation detected in F1 DNA Not yet available
sa45294 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27030 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 95 2532 2 35
Genomic Location (Zv9):
Chromosome 7 (position 49150793)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47418412
GRCz11 7 47691491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAAAACGGRCACGTGCGGACRACAGGCCTCCCCCTTCAGAGAGACAGA[G/T]AGTATCTYCTAACAGTARTGGCTGCAGACCGGCAGGGCAGCCGCAGWCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40994
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 154 2532 3 35
Genomic Location (Zv9):
Chromosome 7 (position 49145037)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47412656
GRCz11 7 47685735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCTTTCTTTTCTCACCCAGCTTTCTTGTCACTCCTGCGGTGTCCTTC[C/T]AAAAGCAGCCAGTGACGTACAGCCTGCTCATCAATCCCAGCAGTCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40993
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 187 2532 3 35
Genomic Location (Zv9):
Chromosome 7 (position 49144936)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47412555
GRCz11 7 47685634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCATCCAGCCTGAGACGGGGGAGATCAGTCTGACCCGCTCTATAGACTA[T/A]GAGAGTGATCAGCACCGCTACCTGCTGCTGGTGAGGGCCAGTGAGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34166
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 442 2532 9 35
Genomic Location (Zv9):
Chromosome 7 (position 49076645)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47344264
GRCz11 7 47617343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTGTTCTTTGTTTTTGTCCCCTCCTCAATCCCTTAGTGTGCCGAGTA[T/A]AAGGAGAAGGCCTCAGTTCTGGAAAATAAGCCTGCAGGATCATTTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40992
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Essential Splice Site 791 2532 14 35
Genomic Location (Zv9):
Chromosome 7 (position 49050056)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47317675
GRCz11 7 47590754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTCCAAGTGTCAGCCAATGATCTTGACCTGGGGCTGAATGGAAAG[G/A]TATGTAATTTTGAGTTGAATTAGCTATTCACTGAATCTGCCTCCGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34165
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 877 2532 16 35
Genomic Location (Zv9):
Chromosome 7 (position 49034200)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47301819
GRCz11 7 47574898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATCAGTGACGTGAACGATAACAAGCCGGTGTTTGCCCAGCCTGTATA[T/G]GAAGTGGACGTGGATGAGGATGCTGACGTGGGCTCCACCGTCCTCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 939 2532 17 35
Genomic Location (Zv9):
Chromosome 7 (position 49026457)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47294076
GRCz11 7 47567155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGCCTGAGGTGGGGACCAYCTTCAWCGCCCAGCCATTGGATTATGAA[C/T]AAAACAAGCTCTACAAGTTGCACGTCTTGGCCTCGGATGGCAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1094 2532 18 35
Genomic Location (Zv9):
Chromosome 7 (position 49023740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47291359
GRCz11 7 47564438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTCCTATTTTTGCGTGTGCTCCGGACAGTTGCCATGGAGATGTGGCT[G/T]AAAATTCTCCCCCTGGCACCTCTGTCATGGAGATGACGGCCACTGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1153 2532 18 35
Genomic Location (Zv9):
Chromosome 7 (position 49023562)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47291181
GRCz11 7 47564260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCAGATATGTTTAACATCAATCCGGCAACTGGGACTGTTTCTGTAT[C/A]GATGTCTGGCCTGGACAGGGAACAGATTGACTCGTATGTATTGGTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27032
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1536 2532 20 35
Genomic Location (Zv9):
Chromosome 7 (position 49017373)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47284992
GRCz11 7 47558071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACACCTGATGCGCAATCTATGTTTTGACACATGGTTTTTTTTTATAA[T/A]GACAGGGAGAATGCCAACCAATGTGCTGGGAAAGGTTTACTCTCCAGATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27031
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1981 2532 27 35
Genomic Location (Zv9):
Chromosome 7 (position 48933908)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47201527
GRCz11 7 47474606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGCTTCAGCTCGGAGGAGTGAATGAGAATCTGCCGTATATCTACCCA[C/T]AACTCCAGCACAAACACTTCACTGGCTGTATCCGAAACCTCATCGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45294
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Essential Splice Site 2414 2532 35 35
ENSDART00000109511 Essential Splice Site 2414 2532 35 35
Genomic Location (Zv9):
Chromosome 7 (position 48879327)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCCTCCCGAGCGGGAACAGCCACCACCACCACCTCCTCCATCTCCTC[A/G]GGATCTGCCACCATCCGCAGGGATGTCCCCCCCTGCCGCTCTCCGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27030
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Essential Splice Site 2414 2532 35 35
ENSDART00000109511 Essential Splice Site 2414 2532 35 35
Genomic Location (Zv9):
Chromosome 7 (position 48879327)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47146946
GRCz11 7 47420025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCCTCCCGAGCGGGAACAGCCACCACCACCACCTCCTCCATCTCCTC[A/G]GGATCTGCCACCATCCGCAGGGATGTCCCCCCCTGCCGCTCTCCGGCTCA
Associated Phenotype:
Not determined