Busch Lab

ZMP

ARMC5

Ensembl ID:
ENSDARG00000078083
Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Human Orthologue:
ARMC5
Human Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Mouse Orthologue:
Armc5
Mouse Description:
armadillo repeat containing 5 Gene [Source:MGI Symbol;Acc:MGI:2384586]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33201 Nonsense Mutation detected in F1 DNA Not yet available
sa33200 Nonsense Mutation detected in F1 DNA Not yet available
sa12239 Nonsense Available for shipment Available now
sa15905 Nonsense Available for shipment Available now
sa824 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa33201
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 19 673 1 11
Genomic Location (Zv9):
Chromosome 3 (position 31208360)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30926399
GRCz11 3 31057241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCCAGGAAGTTTGTGGACCTGGCACTGAGCATCTTGGCCAACTGCTG[C/A]ACTGAAAAGGGGACCAGACTACAAGTGAGGAAATATTCATTATAGTAATA
Long Flanking Sequence:
CTTAACTTAAAGCCACTGGGATATTGTTATACTTATTGTGAAAAATTGTGAAAATAAACAAATTAACTTGACTTATAAGAACAGAGGAGGTGGTGGGGGAGGTGCTTCTGTGTCATCATGTCTTTAGAACAAGGACTTAAACTAAATTTAAAAAGTTCACACTGCGCCTCAGAGGCGTCCACCACTCTCCCAGAATCCTCTCTGACCTGGTGTTTGGCTCAGCTTTCCAAATCAAGTCTATTAGCAGACAGTGGACTGACAGGAGCTGACAACAAGGGTGCCGCAGGAGGAGATAAAGCCAGGGATGCAGACAAGAGACTCAAAGCTGGTCAGTGGAGGGCACTGGTGGCCATTCGGACACAGCACATCAAGGGAGGAGGCAGCAGGATCGCACGCTACCAGTCACGGGGAGGAATCCCTCCTTTGCTCGATCTCCTCAGGCGACCAGAAAGCTCCAGGAAGTTTGTGGACCTGGCACTGAGCATCTTGGCCAACTGCTG[C/A]ACTGAAAAGGGGACCAGACTACAAGTGAGGAAATATTCATTATAGTAATATTTATTATGCAGTTTGTGTAATGTTTTGTAACTGATATAGTGTTTTTATTATTCTTTTCCTACATAGGTAAGAAAGCTGGATGGCGTATCTGTTGTTGGTAAGTCATGCAAAGGCTTCTGAAAGGGATAGTTTACACAAAAATGAGTTATCTGTCATCATTTACTCACACTTCACTTTTTAAAAACTTATTCTTTCTTTTATGAACAAAAGCTATTTTCAGAAATGCTGGTTGATGGTACTCAGTACAGGGTATCTGCGGGGTCTTAGAAAGTTTTAAAATGTCCTAATTTTCAAAAACAAATGTTTTAGGCTTTAAAAAGTCTCAAATTTACAGAAATATTGTGTTGTAGGTCTTAAATAATTTTAAACGGATCTTAATTTTCTTTTGTCCAATTAAAGCTACCCATTCAGGCCCACATCCACCCAATCACCAACAATCTATCTTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 160 673 4 11
Genomic Location (Zv9):
Chromosome 3 (position 31204076)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30922115
GRCz11 3 31052957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGCTGCAGTGCGGAGTGTGCCAGAGAGATGTCCCGCTCTGGGGCTT[T/A]GACTCAGCTCGGGGTTCTGGCTTCGGGAGAAGACGGTCGGCCTTTGGAAG
Long Flanking Sequence:
ATCGATGTACATTTCAGCCTTTAAGTAAGTGAATATTTAAGTAAGTAATATTTGGAAGTAAACCCTGATTATAAATTATATTAAAACTGAATAATTTTTTTTTTTAAATATGTCTTTTTCCATGATATAGATTACACTTTGAGTCACAGACTCATCATATTTGTCTCTCTATCCTGCAGGTGGTGTTCCTCTTCTCCTGCTCTGCCTCTCTGTCTCTCCTCCTCCTCCTCCATCCTCTCCCTCTTCAGTGACTCCAGCCTCTGAACTCTGCGCACCCAAAGTAGAGTGTGTCCAATCTGCCGCCCGGGCTCTTGTCTACCTCTCCGACACCCCTGCCAACCGCCTCCTGCTGCTTTCCCAAGGAGCTCTTCCTGCACTTGCTCAGTTCATTTCTCCAGAATACCCCGCAGGTCTGCAACGGGCGTCTCTGCGCGCCCTTCATGAGCTCACCAGAGGCTGCAGTGCGGAGTGTGCCAGAGAGATGTCCCGCTCTGGGGCTT[T/A]GACTCAGCTCGGGGTTCTGGCTTCGGGAGAAGACGGTCGGCCTTTGGAAGAGCTGGCGTTGAAGACTTTGGCTAATATGTGCTCTCAAGGCAGCCTGAGGCCTCTTGTGGGTTCGTTGGGAGTCATTCAGAAGTTTGCAGAGGAGGTGAAGAAGGACCCTCTGAGGTCGAGTGTGTTTTTTAAGGCCTTGTGTTTGTGCTGCAGGGAAGCTGTGAACAGGGCTAAAGTAAAAGAGAGCGGAGGATTAGAGGTGCTCATCAGTTTTCTGTCGGCTCATCAAAACCATCCGCTCACGCGCTTTGCATTTCTAGCTTGTGTGGACTTCGTTTATGATGAATCGGCTCTCGAGCAGCTGCAGGAGCTCGGGCTGGTGCCGCTGCTCATCAAGCGTTTAGTGGAACTTGCTCAAGGAGAAGAACCAAACACTGGGAAGATGGATGCCAGCCTGGCTTCTAGTTCTCCATGCTCTGAACTCATGAGCTCCTGCTTTAATTCTTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6899
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Essential Splice Site 308 673 5 11
Genomic Location (Zv9):
Chromosome 3 (position 31203492)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30921531
GRCz11 3 31052373
KASP Assay ID:
554-4566.1 (used for ordering genotyping assays)
KASP Sequence:
ATGTGAGTAAAGACCAGACGGCAGGATCCTCCAGCTTYCTCAGCCTYAGG[T/G]CAGCCCATCATAGAATAAATGAATTATGATRATTTTTTTGAATTTTTTTT
Long Flanking Sequence:
CTCAAGGCAGCCTGAGGCCTCTTGTGGGTTCGTTGGGAGTCATTCAGAAGTTTGCAGAGGAGGTGAAGAAGGACCCTCTGAGGTCGAGTGTGTTTTTTAAGGCCTTGTGTTTGTGCTGCAGGGAAGCTGTGAACAGGGCTAAAGTAAAAGAGAGCGGAGGATTAGAGGTGCTCATCAGTTTTCTGTCGGCTCATCAAAACCATCCGCTCACGCGCTTTGCATTTCTAGCTTGTGTGGACTTCGTTTATGATGAATCGGCTCTCGAGCAGCTGCAGGAGCTCGGGCTGGTGCCGCTGCTCATCAAGCGTTTAGTGGAACTTGCTCAAGGAGAAGAACCAAACACTGGGAAGATGGATGCCAGCCTGGCTTCTAGTTCTCCATGCTCTGAACTCATGAGCTCCTGCTTTAATTCTTTTGACTTCTCCGCACTTGAAGGAAACAAGAGGGAGGATGTGAGTAAAGACCAGACGGCAGGATCCTCCAGCTTCCTCAGCCTCAGG[T/G]CAGCCCATCATAGAATAAATGAATTATGATGATTTTTTTGAATTTTTTTTATTTATTTTTTGATCAGATTTGACATTTTGATGAATTTTAGTCTAACAGCACTTTTCAGTAATTCCATATAGATAGTTTAAGATTTGAGATTTTTTTTTCAGTAATAGCTATCTCTCTTTTAAAGTATTTTAATTTAAATGTAAGAAATATGTTCTACTACTAGATCTAAACATTAACGCACCTAACAATACTTTTTAGATTCAAGACCTTTTTTTCTGAAAACATTATTAGTCGGATTGTTAATATATTGCACCCTAACTACAGAACTGTATCATTTGCAGTGTTCTTTTAATATTTTTATTTCAGTGTATTAATCGAAGTTTAAACAGTTCTTCTTTTATTTATTAATTTAAAAAGAATTTTGTATAACTTGATTTTGTCCAGTAATAACAAATAATAATAAATAAATTATTAATACAAAATAAATGAAACAAATGTGTCAGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12239
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 330 673 7 11
Genomic Location (Zv9):
Chromosome 3 (position 31201730)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30919769
GRCz11 3 31050611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTSCCTCCAGGTCTTG[G/A]CTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGTKAGCTGACTGAATGCCC
Long Flanking Sequence:
TATATATATATATATATATATATATATATATATATATATATATATATATATATGAATATACATCTAGCCAATGGCTCTGTTTGAGAAAGTCTCACCTCTCTGATTTGTATTTGGTGATGATGTCTGTGGGTGTCACCGTTCAAAATTAAAGAGCAGCTTTTTTCCTTATAAAAAAAACAAATAAAAACCATAAATTAAAATGTGGACGCATGATAGCTGAACGGGACCCCAAAACTCAGTTTGATGAGAGTTTACTCACACGTGACTTTAGCTATTTTGGTCCGTTTAGAAACTTTGCCGTGTAAAAGCAAACTGCACCAAGAACAAAGTGCAACATTATAACATTTTTAATCCATGTTTTGGAAAATAATAATCAGGCTACAGGTGTGAAAGCACCCTAATATACATCTTCACACTTGGCCATCTTCAGTGACATGTTTGCTTGCTTTGTTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTGCCTCCAGGTCTTG[G/A]CTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGTGAGCTGACTGAATGCCCGAGCGGACCTGATGTGTTTGGTGGCAGCCCTCAGTCCTCCGTCTCATCATCACCACTGCTCACACACTGCCCTGACCTCTCCCTCACCCCAACTTTACGCCCACCACACTTCTCTCCCTCATCTCGCTCCAAACTCACCCGTCCTGCCTCCTCATCCGCTCCAGTATCTCCTCGAAACATACCAGGGTCGCCTTCCTCCACACAGCCCTCCTGCACCTCCACCCCTCAAAATGAGCAACCGTCATCAGTGACCAAACCCTCCACCACCCCCTCATCTCCCCCCCAAATATCCTCTCCCCCCAGAAAGAGGCTCCGTGCAGCTTCATCCTCATCTTCATCCTCCTATACATCATTCTCTTCATTTTCATCATCATCCTCCTGGTCTACTGTGGTCTCCATAGAAACCCCACCCATGATGTCAAAACCCCCAATCTATAATCACCCGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 342 673 7 11
Genomic Location (Zv9):
Chromosome 3 (position 31201696)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30919735
GRCz11 3 31050577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTSCCTCCAGGTCTTGRCTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGT[G/T]AGCTGACTGAATGCCCGAGCGGRCCTGATGTGTTTGGTGGCAGCCCTCAG
Long Flanking Sequence:
TATATATATATATATATATGAATATACATCTAGCCAATGGCTCTGTTTGAGAAAGTCTCACCTCTCTGATTTGTATTTGGTGATGATGTCTGTGGGTGTCACCGTTCAAAATTAAAGAGCAGCTTTTTTCCTTATAAAAAAAACAAATAAAAACCATAAATTAAAATGTGGACGCATGATAGCTGAACGGGACCCCAAAACTCAGTTTGATGAGAGTTTACTCACACGTGACTTTAGCTATTTTGGTCCGTTTAGAAACTTTGCCGTGTAAAAGCAAACTGCACCAAGAACAAAGTGCAACATTATAACATTTTTAATCCATGTTTTGGAAAATAATAATCAGGCTACAGGTGTGAAAGCACCCTAATATACATCTTCACACTTGGCCATCTTCAGTGACATGTTTGCTTGCTTTGTTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTGCCTCCAGGTCTTGGCTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGT[G/T]AGCTGACTGAATGCCCGAGCGGACCTGATGTGTTTGGTGGCAGCCCTCAGTCCTCCGTCTCATCATCACCACTGCTCACACACTGCCCTGACCTCTCCCTCACCCCAACTTTACGCCCACCACACTTCTCTCCCTCATCTCGCTCCAAACTCACCCGTCCTGCCTCCTCATCCGCTCCAGTATCTCCTCGAAACATACCAGGGTCGCCTTCCTCCACACAGCCCTCCTGCACCTCCACCCCTCAAAATGAGCAACCGTCATCAGTGACCAAACCCTCCACCACCCCCTCATCTCCCCCCCAAATATCCTCTCCCCCCAGAAAGAGGCTCCGTGCAGCTTCATCCTCATCTTCATCCTCCTATACATCATTCTCTTCATTTTCATCATCATCCTCCTGGTCTACTGTGGTCTCCATAGAAACCCCACCCATGATGTCAAAACCCCCAATCTATAATCACCCGTATCACCCTGAAGTCTGGGCCCCAGAATCCCCCATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa824
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Essential Splice Site 484 673 8 11
Genomic Location (Zv9):
Chromosome 3 (position 31200915)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30918954
GRCz11 3 31049796
KASP Assay ID:
554-0728.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAACAGACAGACAGTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAG[G/A]TTTGTGACTTTAGTATTCATTGGGATATAAATAATAGGGTATATGCCGAG
Long Flanking Sequence:
CACCCCCTCATCTCCCCCCCAAATATCCTCTCCCCCCAGAAAGAGGCTCCGTGCAGCTTCATCCTCATCTTCATCCTCCTATACATCATTCTCTTCATTTTCATCATCATCCTCCTGGTCTACTGTGGTCTCCATAGAAACCCCACCCATGATGTCAAAACCCCCAATCTATAATCACCCGTATCACCCTGAAGTCTGGGCCCCAGAATCCCCCATTCTCCTGCTGCTGTCCCGCTTCTCTCATGCCCCAGACCCCAGCACAGCGCTCATCAACACCAGCGTTTTCTCCGGGCTCTTGTACTACCTCACCCAGCACCATGACCCCAGTGGCCGGTGCTTTCGGATGCTCGGGAGGCTCAGCTGTAACCCAAACTGCTTGCAGGCTCTGGTCAGAACTGGAGCCGTGGCTCTGATCCGACAGAAACTGTGTGTGAGAGGAGACGAGGCTGGAGGAACAGACAGACAGTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAG[G/A]TTTGTGACTTTAGTATTCATTGGGATATAAATAATAGGGTATATGCCGAGCTAGAGCTGTTCCCATGCTGATACACTTCCGGTGACCTGTTATTGTGAACTTTTTTCCATTTTATACGGTTCCTCATACAGCATCGATGTTGTAATGTCATTAAAATACATTCAGTTAAATAAACTTTAGCATTTATTTGGTTGCTCAAGCGTAAAACGAGACAAAAAGCTGTTTACTCGCACGCGCCCGTCAAAATTGGCAGGCTAACGCAGAAGCTCCATTGAATATACTGGGGTAAAATAGTTGCTCATATTATAAAGATATGGCGGGGGAAATGTAATTTAATGCAGTGCTTTTTGTACAATCCGAGACTCACTTTAAATCGGATATCACTCAGCTAGTGGAGATCGCTGATTTTGAAAGAAAACAGACATTAAACGCACTGGATTTTGCATTGGCATTCAATTCGCCGGAAGCGCCTAACCCAGGTTACTGGCAAATTAAAAGTC
Associated Phenotype:
Not determined