Busch Lab

ZMP

si:ch211-232i5.1

Ensembl ID:
ENSDARG00000078072
ZFIN ID:
ZDB-GENE-070705-127
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5G2]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13560 Nonsense Available for shipment Available now
sa36973 Nonsense Mutation detected in F1 DNA Not yet available
sa9461 Nonsense Available for shipment Available now
sa8827 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13560
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 70 978 2 8
ENSDART00000133637 None None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8287084)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8121353
GRCz11 20 8109092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTCTCGCACCACGTGTAGTCTTTAAAGATGACAAAAATCTCAGTCGC[C/T]AGCTCTCCCCAMCWTGGGGATCAAAACCCAGTGACAACCAGTTCGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36973
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 444 978 2 8
ENSDART00000133637 None None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285962)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8120231
GRCz11 20 8107970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGTCAAAGATTTCTGAGCCAGCCATTACAACACCAGTCATTCCTGAT[C/T]AAACTGTCCCTAAGACTTCTAAACCAGATCCATCTTTTACAACTCTTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29311
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 508 978 2 8
ENSDART00000133637 None None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285770)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8120039
GRCz11 20 8107778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTCCTCCCCCTCTTCTTGAAGATTATCCCGAGGGAGACTTATTAGAG[C/T]AAATCAAACCCACTCCAGCAATCCGTACATCTATCCCCCCAATTTCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637 None None 135 None 5
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637 None None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285183)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8119452
GRCz11 20 8107191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGCTCCATCAGAAGTCCCTGTTATCCCTAAACTCCCWCCAGTTGACTA[T/A]GTAGATCATKCAAGRTTTCCACCTAAAGCCCAAATACCTGAACTGGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8827
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637 None None 135 None 5
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637 None None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285183)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8119452
GRCz11 20 8107191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGCTCCATCAGAAGTCCCTGTTATCCCTAAACTCCCWCCAGTTGACTA[T/A]GTAGATCATKCAAGRTTTCCACCTAAAGCCCAAATACCTGAACTGGCCAA
Associated Phenotype:
Not determined