Busch Lab

ZMP

abcg4b

Ensembl ID:
ENSDARG00000078068
ZFIN ID:
ZDB-GENE-080215-10
Description:
ATP-binding cassette, sub-family G (WHITE), member 4b [Source:RefSeq peptide;Acc:NP_001104682]
Human Orthologue:
ABCG4
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 4 [Source:HGNC Symbol;Acc:13884]
Mouse Orthologue:
Abcg4
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 4 Gene [Source:MGI Symbol;Acc:MGI:1890594]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42544 Nonsense Mutation detected in F1 DNA Not yet available
sa7405 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Nonsense 124 644 4 15
Genomic Location (Zv9):
Chromosome 15 (position 22853727)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23564914
GRCz11 15 23500179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTTAAAAATCTTGTTATGTGCTTTATAGGGAAACAGGGATGACTGGA[C/T]AGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGAACCTTTCGTAAAATG
Long Flanking Sequence:
AGCACCCAGAGGAAACCCACGCGAACACAGGGAGAACATGCAAACTCCACACAGAAACGCCAACGGACCCAACCGAGGCTTGAGTTAGCGACTGTCTTGCTGTGAGGCGAACATGCTACCAACTGTGCCACCGTGCAGCAATTGCAAATTTAGATTAAATTGAAAAATAAATTGTTCTTTGATCAAATTTAATATAAAGAAAATTTAAATAAATTATCACTTTCTACATTTAACAAAAAAATTAAATCGTAAAAATAGATATAGTATAGGAAAAATAGATATAGTAGAATATAGTAATGCATTAAAATAATTACACTAAAAAAGGATAAATTAAATTCAGTTCAAATTTTAATCACAAATGTAATCTAAAATAAATTTTAAAATAGTTTTCTCAATAATATTTAATATTAAATATAAACTAAATTAAATCTATCTTGATTCAAATCTTGAACATTTAAAAATCTTGTTATGTGCTTTATAGGGAAACAGGGATGACTGGA[C/T]AGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGAACCTTTCGTAAAATGTCCTGTTACATTATGCAAGAAGACAAATTGCTGCCTCACTTGTCAGTTCAAGAAGCAATGATGGTGAGTCTCCAGGGTGAATAATGTGGTAAAGGATGCCCCCTAGTGCTGATTTGATGCTAATGCTTATAATACAGTCACATGCAAAAGAAAATGACTGATTTCTCCACTGTTTGTAAGGTATCAGCCAACCTGAAGCTGAATGAAAGCTCAGAGGTGAAAAAAGAGCTGGTAGGTGAAGCTTATCTCCTTGGAAGCTGCACCGGTATGCTTGCTTGCCTTTAAAATTCAGCTCCTTCCTTTGTGTTTATGCTGACCTGTAGATAAAAGAAATCCTGACAGCACTGGGACTTCATGAATGTGTCCACACTCGTACCGTGTCTCTGTCTGGTGGTCAGTGTAAGAGACTGGCTATTGCCCTTGAGCTAGTAAACAACCCTCCAGTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7405
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Missense 138 644 4 15
Genomic Location (Zv9):
Chromosome 15 (position 22853684)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23564871
GRCz11 15 23500136
KASP Assay ID:
554-4030.1 (used for ordering genotyping assays)
KASP Sequence:
GACTGGACAGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGRACCTTTC[G/T]TAAAATGTCCTGTTACATTATGCAAGAAGACAAATTGCTGCCTCAYTTGT
Long Flanking Sequence:
ACTCCACACAGAAACGCCAACGGACCCAACCGAGGCTTGAGTTAGCGACTGTCTTGCTGTGAGGCGAACATGCTACCAACTGTGCCACCGTGCAGCAATTGCAAATTTAGATTAAATTGAAAAATAAATTGTTCTTTGATCAAATTTAATATAAAGAAAATTTAAATAAATTATCACTTTCTACATTTAACAAAAAAATTAAATCGTAAAAATAGATATAGTATAGGAAAAATAGATATAGTAGAATATAGTAATGCATTAAAATAATTACACTAAAAAAGGATAAATTAAATTCAGTTCAAATTTTAATCACAAATGTAATCTAAAATAAATTTTAAAATAGTTTTCTCAATAATATTTAATATTAAATATAAACTAAATTAAATCTATCTTGATTCAAATCTTGAACATTTAAAAATCTTGTTATGTGCTTTATAGGGAAACAGGGATGACTGGACAGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGAACCTTTC[G/T]TAAAATGTCCTGTTACATTATGCAAGAAGACAAATTGCTGCCTCACTTGTCAGTTCAAGAAGCAATGATGGTGAGTCTCCAGGGTGAATAATGTGGTAAAGGATGCCCCCTAGTGCTGATTTGATGCTAATGCTTATAATACAGTCACATGCAAAAGAAAATGACTGATTTCTCCACTGTTTGTAAGGTATCAGCCAACCTGAAGCTGAATGAAAGCTCAGAGGTGAAAAAAGAGCTGGTAGGTGAAGCTTATCTCCTTGGAAGCTGCACCGGTATGCTTGCTTGCCTTTAAAATTCAGCTCCTTCCTTTGTGTTTATGCTGACCTGTAGATAAAAGAAATCCTGACAGCACTGGGACTTCATGAATGTGTCCACACTCGTACCGTGTCTCTGTCTGGTGGTCAGTGTAAGAGACTGGCTATTGCCCTTGAGCTAGTAAACAACCCTCCAGTCATGTTCTTTGATGAACCCACTAGGTAATGATACACTCAGACATGCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7864
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Nonsense 229 644 7 15
Genomic Location (Zv9):
Chromosome 15 (position 22853108)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23564295
GRCz11 15 23499560
KASP Assay ID:
554-2379.1 (used for ordering genotyping assays)
KASP Sequence:
GACATTAAAAGCTGTACTGCAGGAATTGTTCGTTTTGTATTTCAGTGGTT[T/A]GGATAGTGCCTCCTGTTTCCAGGTAGTGTCATTGATGAAGTCTTTGGCAC
Long Flanking Sequence:
TCTCCAGGGTGAATAATGTGGTAAAGGATGCCCCCTAGTGCTGATTTGATGCTAATGCTTATAATACAGTCACATGCAAAAGAAAATGACTGATTTCTCCACTGTTTGTAAGGTATCAGCCAACCTGAAGCTGAATGAAAGCTCAGAGGTGAAAAAAGAGCTGGTAGGTGAAGCTTATCTCCTTGGAAGCTGCACCGGTATGCTTGCTTGCCTTTAAAATTCAGCTCCTTCCTTTGTGTTTATGCTGACCTGTAGATAAAAGAAATCCTGACAGCACTGGGACTTCATGAATGTGTCCACACTCGTACCGTGTCTCTGTCTGGTGGTCAGTGTAAGAGACTGGCTATTGCCCTTGAGCTAGTAAACAACCCTCCAGTCATGTTCTTTGATGAACCCACTAGGTAATGATACACTCAGACATGCATAAAACAGCATTATTTAGATGCTTGTGACATTAAAAGCTGTACTGCAGGAATTGTTCGTTTTGTATTTCAGTGGTT[T/A]GGATAGTGCCTCCTGTTTCCAGGTAGTGTCATTGATGAAGTCTTTGGCACAAGGAGGCCGGACCATCATTTGCACCATTCACCAGCCCAGTGCCAAACTCTTTGAGATGTTTGATAAGGTAAATAAAAAGGCATGTGCAAGTCTTCATTTTCAGAAGCTGAAAGCTTTTTGGATCATCTTTTTTGTTTCTTGGTTTGCTTTACAGCTCTATATTTTAAGCCAAGGCCAATGTATATACAAAGGAAGTGTCCCATACCTGATTCCTTACTTGAGAGGACTGGGTCTTCACTGCCCCACATACCACAATCCCGCAGATTTCAGTAAGTTAGTCATTCAAATAAAGTGGCCACTTTATTAGGTACACCTAATTGATACTCTGTTTTGCCTTAAGAACTGCTTTAATTTTTCATTGAATTGATTTCTCAGGTATTTTGGTCAATATTGATGTGATGGCATCATGCAGTTGCTTAAGACCAATACAAATCCATAAAATCGTCTGT
Associated Phenotype:
Not determined