Busch Lab

ZMP

si:dkeyp-51b7.1

Ensembl ID:
ENSDARG00000078050
ZFIN ID:
ZDB-GENE-081105-128
Description:
PHD finger protein 19 [Source:RefSeq peptide;Acc:NP_001121998]
Human Orthologue:
PHF19
Human Description:
PHD finger protein 19 [Source:HGNC Symbol;Acc:24566]
Mouse Orthologue:
Phf19
Mouse Description:
PHD finger protein 19 Gene [Source:MGI Symbol;Acc:MGI:1921266]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21215 Nonsense Available for shipment Available now
sa1129 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa21215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113286 Nonsense 125 563 4 14
ENSDART00000142150 Nonsense 125 562 5 15

The following transcripts of ENSDARG00000078050 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12908423)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12353186
GRCz11 8 12390891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTTCCTCATGCTTGTCTTGCATCTTCAGGCTTTCATCAGCTCTG[C/A]CACTTGCCCACGGTGGAGAGCTCAGCTGACCCATCGCCTTGGTTCTGCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3693
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113286 Essential Splice Site 319 563 9 14
ENSDART00000142150 Essential Splice Site 318 562 10 15

The following transcripts of ENSDARG00000078050 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12894928)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12339691
GRCz11 8 12377396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCGAGGCCAGTTAATTCTTGATGCTCTCAAYAACTATAAAAGCAAG[T/A]AAGAAAAAATGTCTTGATTATCTGGTTAAAGTTAAAGCATACNNNNNTTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1129
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113286 Nonsense 367 563 10 14
ENSDART00000142150 Nonsense 366 562 11 15

The following transcripts of ENSDARG00000078050 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12892490)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12337253
GRCz11 8 12374958
KASP Assay ID:
554-1040.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAGGCCCAAAAAAGTGATGCACATAGGGGACGCAAAAAAGCAGTCAGC[A/T]GAAGCAGGTTAGTTTCACAATCTCTGAGCATTTCTGACAACCTTTTGTTT
Associated Phenotype:
Not determined