Busch Lab

ZMP

FYCO1 (2 of 2)

Ensembl ID:
ENSDARG00000078022
Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Human Orthologue:
FYCO1
Human Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Mouse Orthologue:
Fyco1
Mouse Description:
FYVE and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:107277]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11360 Nonsense Available for shipment Available now
sa14590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11360
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111145 Nonsense 46 1372 2 18
ENSDART00000114182 Nonsense 46 1347 2 17
Genomic Location (Zv9):
Chromosome 2 (position 51333231)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50992274
GRCz11 2 50726494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACACCGAAGAKCCCATCACCGATGACAGCTCCAGCCTTCACAAGTTCTG[T/A]TTTAAACTGGAGTACCTGCTGCAAGTATGGCTCAGNTTTTTTGTCTTRCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6867
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111145 Nonsense 697 1372 7 18
ENSDART00000114182 Nonsense 697 1347 7 17
Genomic Location (Zv9):
Chromosome 2 (position 51347004)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51006047
GRCz11 2 50740267
KASP Assay ID:
554-4980.1 (used for ordering genotyping assays)
KASP Sequence:
CCGGGCACAACTATTGGTGATCTCAGAGGAGAGGATGAAAATCCAGGCAT[T/A]GCAGGAAGTGACAGAAGCCTCTAGAGAAGATCTCCGAGCTCAGACRGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14590
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111145 Nonsense 765 1372 7 18
ENSDART00000114182 Nonsense 765 1347 7 17
Genomic Location (Zv9):
Chromosome 2 (position 51347209)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51006252
GRCz11 2 50740472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATGCGTGCCGAAATYCAAACTAGCATGACTTCAATGAAGGAAGAGTG[T/A]CATGCTTTGAAGAAGCACAACAGCACACTTGCACTTGAGAATGGAGAGGC
Associated Phenotype:
Not determined