Busch Lab

ZMP

si:ch211-221b16.9

Ensembl ID:
ENSDARG00000078001
ZFIN ID:
ZDB-GENE-070912-204
Description:
Novel protein similar to vertebrate kelch repeat and BTB (POZ) domain [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologues:
KBTBD6, KBTBD7
Human Descriptions:
kelch repeat and BTB (POZ) domain containing 6 [Source:HGNC Symbol;Acc:25340]
kelch repeat and BTB (POZ) domain containing 7 [Source:HGNC Symbol;Acc:25266]
Mouse Orthologues:
Gm5465, Kbtbd7
Mouse Descriptions:
kelch repeat and BTB (POZ) domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2685141]
predicted gene 5465 Gene [Source:MGI Symbol;Acc:MGI:3643058]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34600 Nonsense Available for shipment Available now
sa15388 Nonsense Available for shipment Available now
sa21458 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34600
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 51 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17940384)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17416454
GRCz11 9 17424166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTAGTGGACGTGACCATAGAAGTGGAGCCTGACACCGAAACAGCAGAG[C/T]GAAGTGTTTCCTCTGGTGCTGGAAAAGTGTTTCAGTGTAGCAGGAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15388
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 74 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17940455)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17416525
GRCz11 9 17424237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAAAGTGTTYCAGTGTAGCAGGAATATACTGGCAGCRGCGAGCCCTTA[T/G]TTTAAGAGCATGTTTACAGGAGGACTGTACGAGAGCACGCAGAGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27375
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 216 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17940880)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17416950
GRCz11 9 17424662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCTCATGCTGGATTCTTTGGATGTTGACTGTGAGCGTAAAGTGTGCT[C/A]ATTCGCAGTACAGTGGATTGAAAGTAATTTACATGAAAATTCAGAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 455 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17941598)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17417668
GRCz11 9 17425380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAATGAACGCCTTTATGTGGTAAACAAGAGGAGGATGCTGTGCTA[C/A]GAGCCAAAGAAAAACCACTGGCTCCAGCGGGCCTCTCTGAAGCGCAGTAA
Associated Phenotype:
Not determined