Busch Lab

ZMP

WDR1

Ensembl ID:
ENSDARG00000077991
Description:
WD repeat domain 1 [Source:HGNC Symbol;Acc:12754]
Human Orthologue:
WDR1
Human Description:
WD repeat domain 1 [Source:HGNC Symbol;Acc:12754]
Mouse Orthologue:
Wdr1
Mouse Description:
WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12687 Nonsense Available for shipment Available now
sa22400 Splice Site, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28224
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111971 Essential Splice Site 77 606 3 24
Genomic Location (Zv9):
Chromosome 14 (position 277550)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 303568
GRCz11 14 167602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATCGTGGCCAAATACTGTCCCAGTGGCTTCTACATCGCATCGGGCGG[T/G]GAGTGAGTGTGAGTGCGTGCGAGTGCATGTGAGTGAGTGAGTGTGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12687
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111971 Nonsense 141 606 5 24
Genomic Location (Zv9):
Chromosome 14 (position 278342)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 304360
GRCz11 14 168394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGCAGGTTTGGTGCAGTGTTCCTCTGGGACACCGGTTCTTCAGTGGGG[G/T]AGATTGTGGGTYAMAGTAAGATCATCAACAGTGTGGACATCAAGCAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111971 Splice Site, Nonsense 209 606 8 24
Genomic Location (Zv9):
Chromosome 14 (position 278630)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 304648
GRCz11 14 168682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATTGTACATGATATACTCAACATTTAGTACAAGTGATGCCATGAACA[G/T]AGCCAATGCTGCTGAGACGCCATCAAAACACAGAGAAATACAGTAATGCA
Associated Phenotype:
Not determined