Busch Lab

ZMP

LOC794507

Ensembl ID:
ENSDARG00000077979
Human Orthologue:
TMEM26
Human Description:
transmembrane protein 26 [Source:HGNC Symbol;Acc:28550]
Mouse Orthologue:
Tmem26
Mouse Description:
transmembrane protein 26 Gene [Source:MGI Symbol;Acc:MGI:2143537]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42912 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42912
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113655 Nonsense 142 318 4 6
Genomic Location (Zv9):
Chromosome 17 (position 20782074)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20932085
GRCz11 17 20951921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGCATGCTGACCTCCGTCTGTGCGAATGACTGGATCCTTGCCCTTCAT[C/T]AGGTTCTACTCATTCTACTCATCCTTGGAAAGTGGCTCCTTCCATTAGGG
Associated Phenotype:
Not determined