Busch Lab

ZMP

ENSDARG00000077954

Ensembl ID:
ENSDARG00000077954

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25353 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa481 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 46 347 1 6
Genomic Location (Zv9):
Chromosome 7 (position 9142619)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8089984
GRCz11 7 8335942
KASP Assay ID:
554-7325.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTGGTGATGAAACTAGAGGTACAAGAACGTGAAGGGGAAGAAAAA[G/A]TGGATGAACTTCAAATGAAGCTGCTGGAAGTGGAACGATTGGGTGCATTG
Long Flanking Sequence:
CGGATTCGCAGATTTCCCAAACACAAATAACAGAACTTCTGGAGAAGATTGAGAAGATGGTGGCGGGAAATCGCTGTGAGGCATTCTTGCCACTAGTGCATGAGATTCAAGATTTGGGAAGACAAAAGAATGAGAAGTTTCAACTGAGAGTCAAGGAGTTCAACGAGAAGCTTCAACGGCAGGAGGAGGAACTGAAGAAGATGAAGGAACGAGAGGTTAGGAGCATTCGGTGGTTCTTCGAAAGACGCAAAAAAGATAAAGTGCAATCTCCTGGGAAGGCTGAGAGAGAGGAAGTGCAGTATAAGGGTGAAGATGACCGGAGAAGTGTGATGGGTGAGCTTGAGGAGAGGATGGCTTGGTTAACGGAAGACAAGGAGCAAGAGTTGCAAGAGCTGAGCTCTAAACTGAGCAAAGTCATGGTGAGTTACGATCACTTATTGAAAGAGAAAGAGCAGCTGGTGATGAAACTAGAGGTACAAGAACGTGAAGGGGAAGAAAAA[G/A]TGGATGAACTTCAAATGAAGCTGCTGGAAGTGGAACGATTGGGTGCATTGATGGAGCAAGAGCGGAAAGAGAGAGATGCTGAAATTCAGCATAAACATGTGGATGAGATGAATGAGCTTCTAAACCAATTGATGGATGCTAAAAAAGAGAGGGAAATGATGAAAGGGAAGGTTGAAGAGACTCAAAAAGAGATGGATGCATCACAACAGAGACATCAAGAAGAGATCACAATGAAAGAAAGCCAACTGAAGGCAAAGGATAATAAAATTGAAAAGCTTTCCAGAGAAATCGAAGAGGCGAAACGCAATGCTGTGAACACAGAAAAAGAACGAAACGATAAAGATGAGGAGAAAGAGAAAGAGATGGACAAGCTCAGAGAGATGATAGAGATGATGACCAAAGAGATGGAGCAGCTGCGGATGTCCTTTCAAGAGCAAGTGAAGACGACAGAAGCTGAGAGAGAAATGCATGACAGTGTAGTCGAGAAATACAACAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Essential Splice Site 47 347 2 6
Genomic Location (Zv9):
Chromosome 7 (position 9143899)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8091264
GRCz11 7 8337222
KASP Assay ID:
554-0308.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAAATGTAAAAACAACATGCTATCAAACATTGAGGAAAGTGCTGCTCA[G/T]ATGAAGCGTTTAGAGGAAGAATTAAAAATAAAAGAGGAGGAAATCACTCA
Long Flanking Sequence:
ACAAAAGATGATGAAATAATCAAATTAAAACAAGGCGAGCTGGAGAAAGACAAAGACATTAAAATACTAATGCAAAGCATTATCGAAAAACAAGCTGAAATTGACAAGTTAGGAGACAATGCACAAGAAAATGCTGCTCAGCTAATACATTTACAAGAGGCAGTCAAAGAAAAGGAAGGAGAAATAGAAAAATTAAGTCAAAGAGGCCAAGAGAAAGAACGAGAAATTGACATACTTAAGCAAAACATCGCCAAAAAACAGAACGATGTTGAAAAATTAAGAGAAAGCATCCAGGAACACATTACGCAAAGTGCAGCTCAACTTAAGCAATTAGAGGAAGAGGTGGAAATAAGAGAAGAGGAAATAACCAAATTAAGACAAAGAGAGCTGCAGAAAGACAAAGAAATTCACACACTTACGGAAAACATTGCAGGCCAAAAGCAGGATGCTGAGAAATGTAAAAACAACATGCTATCAAACATTGAGGAAAGTGCTGCTCA[G/T]ATGAAGCGTTTAGAGGAAGAATTAAAAATAAAAGAGGAGGAAATCACTCAATTAAGAGCAAAAGAGCTGGAGAAAGACAGAGAAATGAACAAACTGTTGGAAAACATTAACGAAAAGCAGACAGACATTGAAAAGTTAAGAGAGAGTGTTGAGGAAACTGCAGCTCAACTACAGCATTTACAAGAAGAGCTACGAAATAAAGAAGATGAAATGGCTAAATTAAACCAAAGAGAGCTGGAGAAAGATAAAGAAATTCACACGCTTATGGAAAACATTGTCAGCCAAAAGCAGGAAGCTGAAAAATATAAAAACAACATGCAATCAAACATTGAGGAAAGTGTTGCTCATATGAAGCATTTAGAGGAGGAATTAAAAATAAAAGAGGAGGAAATCACTCAGTTAAGAGCAAAAGAGCAGGAGAAAGACAGAGAAATGAACACCCTGCAGGAAAACATTAACGAAAAGCAGGCAGACATTGAAAAGTTAAGAGAGAGTGTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8258
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114789 Nonsense 319 347 6 6
Genomic Location (Zv9):
Chromosome 7 (position 9145886)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8093251
GRCz11 7 8339209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATAAATGAAAAGCAGGAGATGGAGGTGCAAGTGTACAGGATTAGAGAA[G/T]ARGAGAAGAATCTGGAAAATGAGAGTGAGAATAACAAACGCCTGGCTGAA
Long Flanking Sequence:
AACATTATGAGGAGACTAGACTGAAAATTAAAGAGAAGGAACGTATCATCAGTCAATTACAACAACAGTGTGAAGATGCTGATAGATGCTTGGAGGAGCTAAAACAGCAAAATATAGAAGAGCAAGAGCAAAACAATAACCTTAAAAACGTGAATGGAGAACTGGAGAAAGTGCTGAAGATTTCCGATGAGCGCTGTGAAGAGCAAACTGCAGAATTAAAGGGGTTAAAAGAAGAGATGGATGAGGTGAAACAACTGCTTGACGAAAAGGAGAAGGATTTGCAAGACATGAAGGTGTATTATGATGAAAAACTAAGAGAAAGGCATGAGGAGAATGAGATGAAGGATATAGAGACTGAACAAGAGCTTCGAAGGAGAGAGAGAGGGGTTGAAAAGAGAGAAGAGAAACTGCAAACGAGAGAGGATGAAATGAATAGGAGAGAACAAGAGATAATAAATGAAAAGCAGGAGATGGAGGTGCAAGTGTACAGGATTAGAGAA[G/T]AGGAGAAGAATCTGGAAAATGAGAGTGAGAATAACAAACGCCTGGCTGAAGATCTGCTGCGGATGACAGAGGAGGTTCAGAAAAAGGAGGAGGCACTGAAGGACAAAGAGGATGTTTTAAACATGCAGGAGAAGGAGATTAAAGTTAAAATGGTTGACTTGCAAGCAACCGAGAATATACTGGAAACTAAACAGAAGGAAATTAAAGATCTGACTGAAAAGCAGGAGAAAGATATGGAAAACCTTAGACAGAAGTTGAAGAGAAACGAACAAGAGCTGATGGAAATGAAGGAGAGTTTTGATAAAGACCAACACAGGCTTAAAGAAGAAGAAAAGTTTTTGGAAGTGCTCAAGGCGAATCTGGAAACCAGAGAAAATGAGCTTAATAAACGTGAGCAGATGTGGGAAGTAAAGACCCAAGAGCTTTTAAAGCGCTCAGAGGAACTTCAAAACAACAAATGTGCAATGGAGAAATGGCAAGCCCAGCTGAGGAATCAGGAA
Associated Phenotype:
Not determined