Busch Lab

ZMP

zgc:194678

Ensembl ID:
ENSDARG00000077940
ZFIN IDs:
ZDB-GENE-030131-8082, ZDB-GENE-030131-8082
Description:
V-set and transmembrane domain-containing protein 2B [Source:RefSeq peptide;Acc:NP_001122250]
Human Orthologue:
VSTM2B
Human Description:
V-set and transmembrane domain containing 2B [Source:HGNC Symbol;Acc:33595]
Mouse Orthologue:
Vstm2b
Mouse Description:
V-set and transmembrane domain containing 2B Gene [Source:MGI Symbol;Acc:MGI:1914525]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21052 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21052
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110590 Essential Splice Site 231 260 4 5
ENSDART00000124876 Essential Splice Site 231 260 4 5
Genomic Location (Zv9):
Chromosome 7 (position 46060879)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44733707
GRCz11 7 45072932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGCCTCGGCCAGGCAATTCATCTATCCTGAGACAACAGCACGGATCCG[G/C]TGAGTGACAGTGCAACAGCGACACCGAGCGGTCGAGAGAGGAACATTTCA
Associated Phenotype:
Not determined