Busch Lab

ZMP

relnl

Ensembl ID:
ENSDARG00000077935
ZFIN ID:
ZDB-GENE-040427-1
Description:
Reelin [Source:UniProtKB/TrEMBL;Acc:Q8AYT0]
Human Orthologue:
RELN
Human Description:
reelin [Source:HGNC Symbol;Acc:9957]
Mouse Orthologue:
Reln
Mouse Description:
reelin Gene [Source:MGI Symbol;Acc:MGI:103022]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43187 Nonsense Mutation detected in F1 DNA Not yet available
sa6540 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23393 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43187
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025746 Nonsense 97 308 3 7
Genomic Location (Zv9):
Chromosome 18 (position 49786406)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50942335
GRCz11 18 50859971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCAGTTCCGCTGGATCCAGATGGAGGCTCCAGGCGAGCGCTACAGCT[G/A]GGCTGTGGACCAGGTCTACATCGGGGAGGCGTGCGCCGGACTGTGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6540
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025746 Essential Splice Site 271 308 6 7
Genomic Location (Zv9):
Chromosome 18 (position 49787781)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50943710
GRCz11 18 50858596
KASP Assay ID:
554-5307.1 (used for ordering genotyping assays)
KASP Sequence:
GGTCTCCGTCATTACTGAACWGCAGGTAACGTGTGTGTTGTGTGTGCTGC[A/T]GTGAGGCGCGGGTCCGAGGCGTTCAGCTGCGGTGGTGGCAGSCGCGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025746 Essential Splice Site 304 308 6 7
Genomic Location (Zv9):
Chromosome 18 (position 49787882)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50943811
GRCz11 18 50858495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGCACAGGCCACGACCAGTGGGCACTGGACCATGTGGAAGTCATTCT[G/A]TGAGTACTCCTGCCTACAGACACCGTATCACAGCTGTGTTTTCTCATTCC
Associated Phenotype:
Not determined