Busch Lab

ZMP

zgc:162965

Ensembl ID:
ENSDARG00000077883
ZFIN ID:
ZDB-GENE-041111-264
Description:
Protein FAM83D [Source:UniProtKB/Swiss-Prot;Acc:A4QP72]
Human Orthologue:
FAM83D
Human Description:
family with sequence similarity 83, member D [Source:HGNC Symbol;Acc:16122]
Mouse Orthologue:
Fam83d
Mouse Description:
family with sequence similarity 83, member D Gene [Source:MGI Symbol;Acc:MGI:1919128]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11577 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa715
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112209 None 5 534 1 4
ENSDART00000124864 Essential Splice Site 18 546 2 5
ENSDART00000141478 None 5 95 2 2
Genomic Location (Zv9):
Chromosome 11 (position 26261884)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25090709
GRCz11 11 25328325
KASP Assay ID:
554-0623.1 (used for ordering genotyping assays)
KASP Sequence:
AACGCTTGTGYGTGTGAGACTGAGAAACTTTYAGTCATGGCTCTTTCCCA[G/A]TGTCTCGAGGACTCACCAGGCTGGCGCACACCGAGGAAAGAGCAGGACTC
Long Flanking Sequence:
TTTGTAAGTCTCGTGTTTACCACACTGTATGCTGGCCACATTGTATAGCCATACTGTATATCACAATACAAGTTCAAAAGCAAAATGCGTTATGAAAACGAGCTGCTTAAACATCTTGCTATAACTTTTATACTGTCTGTTTATATGAAGTATTATTACCTGTACTTTATGAGGCCATTTAGTTTCACAACACCACCGGGCGTGAACATTACAACACACAAACTGTAAAAAAAAAAAAAGCGAAAATCACCCACGCCGCTTTTGTTTGCCTCCAAATTCAAACTCTTGACCAATAGACGCAGAGCACACTGTCCAATAGCGTCCTTTCTCAGCAGACACGTGACGCCACAACTAGACTGGCAACAACGTAGCAACCAATGGTGGCTCTCCAGCTGTGGGACGAGTCTTCTGGAAAGTACAGCTTACAGGTGGGTGATTTTCATATTTGGGAACGCTTGTGCGTGTGAGACTGAGAAACTTTTAGTCATGGCTCTTTCCCA[G/A]TGTCTCGAGGACTCACCAGGCTGGCGCACACCGAGGAAAGAGCAGGACTCGAACCTTAACGAGCTCTACAATGAGAGACACCGACTGGCTTTGGAGGAGCTGGTGGCCGGGGGAGTGCAGTCATTCATGGGCTTCCTCAAGAAAGAGAGAATGCCCAACTTTCTATCCGAAGACGAGATCAGGAGGGTTTATCGCGCGGCTGTGGTGCCCAAAACAATCTCAATCAACGGAGACGATTCTCATCTGGATCAGTCGGGCACCCTGGACTGCTCATCTGTCACTTACTTCCCGGAGGTCTCTGACATTGAGCCCCCGGTGCTGGAGAACGGCTGGCCGGCGTTCACTGCAGGCTCGTACCGCGGAGTAACGCGAGCGGTCGCCTACTTCCAGCCGAGCTACGGAGAGTGCATTTACAGCTGCAAAGAAGCAGCCAGGAGGATGATCAGAAATGCCAAGGAGGTATTGCTGATATAAAGAAATAGATTTGAATATTTTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11577
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112209 Nonsense 108 534 1 4
ENSDART00000124864 Nonsense 120 546 2 5
ENSDART00000141478 None None 95 None 2
Genomic Location (Zv9):
Chromosome 11 (position 26262191)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25091016
GRCz11 11 25328632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACCCTGGACTGCTCATCTGTCACTTACTTCCCGGAGGTCTCTGACATT[G/T]AGCCCCCGGTGCTGGARAACGGCTGGCCGGCGTTCACTRCAGGCTCGTAC
Long Flanking Sequence:
ACTGTCCAATAGCGTCCTTTCTCAGCAGACACGTGACGCCACAACTAGACTGGCAACAACGTAGCAACCAATGGTGGCTCTCCAGCTGTGGGACGAGTCTTCTGGAAAGTACAGCTTACAGGTGGGTGATTTTCATATTTGGGAACGCTTGTGCGTGTGAGACTGAGAAACTTTTAGTCATGGCTCTTTCCCAGTGTCTCGAGGACTCACCAGGCTGGCGCACACCGAGGAAAGAGCAGGACTCGAACCTTAACGAGCTCTACAATGAGAGACACCGACTGGCTTTGGAGGAGCTGGTGGCCGGGGGAGTGCAGTCATTCATGGGCTTCCTCAAGAAAGAGAGAATGCCCAACTTTCTATCCGAAGACGAGATCAGGAGGGTTTATCGCGCGGCTGTGGTGCCCAAAACAATCTCAATCAACGGAGACGATTCTCATCTGGATCAGTCGGGCACCCTGGACTGCTCATCTGTCACTTACTTCCCGGAGGTCTCTGACATT[G/T]AGCCCCCGGTGCTGGAGAACGGCTGGCCGGCGTTCACTGCAGGCTCGTACCGCGGAGTAACGCGAGCGGTCGCCTACTTCCAGCCGAGCTACGGAGAGTGCATTTACAGCTGCAAAGAAGCAGCCAGGAGGATGATCAGAAATGCCAAGGAGGTATTGCTGATATAAAGAAATAGATTTGAATATTTTTTTCCCCCTTTTGCCTTGTTGAAGCTTCTTGATTCTTGTTGGTGAATTTATGTGTTGTAATAATTAATCAGTTCATTCTTATTGACGCTAAAGTTAGTGTTTGGGAAACAGTAATATATTACAATCTAAAGTCTTTTTAGGTAGCTAAAGGTGTTAGTTACTTTTTAATTAAAGTTAAAGTAAGCGTTATGCTATTATTACATGTTTATTAGAGTAAGATATACTAATAATAATATATACTAATAGTAATATATACCGTAATATATTACTTTGTTTTGCTCAACAGACATCCATGCTAACTAATCTAAAGTA
Associated Phenotype:
Not determined