Busch Lab

ZMP

NP_001122273.1

Ensembl ID:
ENSDARG00000077858
Description:
hypothetical protein LOC798574 [Source:RefSeq peptide;Acc:NP_001122273]
Human Orthologue:
ASIP
Human Description:
agouti signaling protein [Source:HGNC Symbol;Acc:745]
Mouse Orthologue:
a
Mouse Description:
nonagouti Gene [Source:MGI Symbol;Acc:MGI:87853]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13992 Essential Splice Site Available for shipment Available now
sa18595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13992
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113083 Essential Splice Site None 125 1 4
Genomic Location (Zv9):
Chromosome 6 (position 49934932)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49984613
GRCz11 6 49983266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCAGCTTCACARAGGGAAAACTGGGGGCCTCAGTACTCACAAGGACAG[G/A]TCAGTTTGTAAATTCCCAACAGCGACTACTGAAGATTACCATGGGTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18595
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113083 Nonsense 94 125 4 4
Genomic Location (Zv9):
Chromosome 6 (position 49927947)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49977628
GRCz11 6 49976281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGAGACCCCCGCCTCCGCCGAACTGTGTGCCCCTGTGGGCGAGCTGC[A/T]AGAGCCCGAACGCGGTGTGCTGCGAKCAGTGCGCTTTCTGCCACTGCCGC
Associated Phenotype:
Not determined