Busch Lab

ZMP

samd11

Ensembl ID:
ENSDARG00000077852
ZFIN ID:
ZDB-GENE-060428-2
Human Orthologue:
SAMD11
Human Description:
sterile alpha motif domain containing 11 [Source:HGNC Symbol;Acc:28706]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13428 Essential Splice Site Available for shipment Available now
sa43976 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13428
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109516 Essential Splice Site 308 874 5 14
ENSDART00000132418 None None 167 None 4
ENSDART00000146415 None None 171 None 3
ENSDART00000146463 Essential Splice Site 308 874 5 13
Genomic Location (Zv9):
Chromosome 23 (position 23383370)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23162677
GRCz11 23 23089228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCGAGTGCCCATCTGACAGCAAGAAGTCCCGCAGCGTGTCACCTAAAG[G/T]TAGGGGCCCCTCTCTCGTGCATGTGTGTGCANNTGTGTGTGTGCTGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109516 Nonsense 328 874 6 14
ENSDART00000132418 None None 167 None 4
ENSDART00000146415 None None 171 None 3
ENSDART00000146463 Nonsense 328 874 6 13
Genomic Location (Zv9):
Chromosome 23 (position 23390547)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23169854
GRCz11 23 23096405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACACGCCTGCGCTGGAGCCGGGCAGTCACATGACCCCCGAGGAGCACTA[C/A]AGGCGCATGATGTCAGCGCTGAACGAGCATGGCTCTTATGAGGAGCAGCA
Associated Phenotype:
Not determined