Busch Lab

ZMP

olfm2

Ensembl ID:
ENSDARG00000077847
ZFIN ID:
ZDB-GENE-040426-2882
Description:
olfactomedin 2 [Source:RefSeq peptide;Acc:NP_997882]
Human Orthologue:
OLFM2
Human Description:
olfactomedin 2 [Source:HGNC Symbol;Acc:17189]
Mouse Orthologue:
Olfm2
Mouse Description:
olfactomedin 2 Gene [Source:MGI Symbol;Acc:MGI:3045350]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5231 Essential Splice Site F2 line generated Not yet available
sa11276 Nonsense Available for shipment Available now
sa10851 Nonsense Available for shipment Available now
sa11140 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5231
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109894 Essential Splice Site 49 483 2 6

The following transcripts of ENSDARG00000077847 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55058952)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53952868
GRCz11 3 54207531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCATCCATCTCCNNTTTTTTTTCCTCATCTCTTSCTCTCTTTCTCCACGC[A/T]GGCCCTGTATCCAAGCCCGGAGGAGGGCTGGCAGATCTACAGCTCGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11276
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6

The following transcripts of ENSDARG00000077847 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55088610)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53982526
GRCz11 3 54237189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCTTCCATAACCAATACTCCCACATCTCCATGATGGACTACAATCCC[C/T]GAGAAAGAGTTCTCTACACCTGGAACAATGGACATCAAGTCCTCTACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10851
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6

The following transcripts of ENSDARG00000077847 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55088610)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53982526
GRCz11 3 54237189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCTTCCATAACCAATACTCCCACATCTCCATGATGGACTACAATCCC[C/T]GAGAAAGAGTTCTCTACACCTGGAACAATGGACATCAAGTCCTCTACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6
ENSDART00000109894 Nonsense 455 483 6 6

The following transcripts of ENSDARG00000077847 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 55088610)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53982526
GRCz11 3 54237189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCTTCCATAACCAATACTCCCACATCTCCATGATGGACTACAATCCC[C/T]GAGAAAGAGTTCTCTACACCTGGAACAATGGACATCAAGTCCTCTACAAC
Associated Phenotype:
Not determined