Busch Lab

ZMP

meis2.1

Ensembl ID:
ENSDARG00000077840
ZFIN IDs:
ZDB-GENE-000210-23, ZDB-GENE-020122-2, ZDB-GENE-020122-2
Description:
myeloid ecotropic viral integration site 2.1 [Source:RefSeq peptide;Acc:NP_570985]
Human Orthologue:
MEIS2
Human Description:
Meis homeobox 2 [Source:HGNC Symbol;Acc:7001]
Mouse Orthologue:
Meis2
Mouse Description:
Meis homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:108564]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23645 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4882
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033976 Essential Splice Site 148 393 None 13
ENSDART00000144970 Essential Splice Site 148 393 None 14

The following transcripts of ENSDARG00000077840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 10303834)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10129508
GRCz11 20 10116748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGTGCAGAGAAGCCGTTATTTTCCTCTAACCCAGAGCTGGATAATTTGG[T/A]AAGTRTAAGATTTTATTTGGCGCTGTTTTGTTTCAGGTAAATTCGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033976 Essential Splice Site 345 393 11 13
ENSDART00000144970 Essential Splice Site 345 393 12 14

The following transcripts of ENSDARG00000077840 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 10289724)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10115398
GRCz11 20 10102638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTATCAGTGCGAGCGTATATCACATTTATATTGTGTTTTTGTGTGTTT[A/G]GTAAGTCAAGGAACCGCTTACAGCCCTGATGGTCAGCCTATGGGCGGCTT
Associated Phenotype:
Not determined