Busch Lab

ZMP

HMGXB3

Ensembl ID:
ENSDARG00000077823
Description:
HMG box domain containing 3 [Source:HGNC Symbol;Acc:28982]
Human Orthologue:
HMGXB3
Human Description:
HMG box domain containing 3 [Source:HGNC Symbol;Acc:28982]
Mouse Orthologue:
Hmgxb3
Mouse Description:
HMG box domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2441817]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35625 Nonsense Mutation detected in F1 DNA Not yet available
sa9952 Nonsense Available for shipment Available now
sa10782 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3895
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 436 1222 7 20
Genomic Location (Zv9):
Chromosome 14 (position 3081923)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2833611
GRCz11 14 3084728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGCATTGGGTGGTGGTCAGATTCAGATTATCGCTAGAGAAAAAGCCTG[C/A]AGTGCTGTGCAGAAACGACGCATACGAGCTATTCTTCCAGCGCCATCACA
Long Flanking Sequence:
ATTCACTTTGAATGGGTTCGTTGCCGAACTGCATTGTGGACCCGTCGACGCCGCTTCAGAGGCGTTGTTCGTTGTAGAAGTTGGGACTAGCACAACTTCTCAAGCGCCAATGGAAGCGTCAGCCAATCAGATCACTGTATGCAAATACACCAGCTAGACTGTGGCCTATTGCTGACTGAATTTCATTGGCTGATGCTGCTATGACGACAGCGTCAGCCCCTACTTCAGACTCGCCTTCAGTCAAGCATTGACGCTGAAGCCCCGTGTGAATGGGGCGTTAGTATGTTAATGCTCCCTAAAATGTGAGGCGCACAGGACGCATAAGCAGCCCTGAAAATGCTCACAGCCATTTGAAAACCATTAAAAAAAGGCACCTCTCAACACAAAAATGGGTTTGATCAAGGCATAAATGTCTCTATTAGTCTTTAATGTGTGTTTTTGTGTCATTTCAGAGCATTGGGTGGTGGTCAGATTCAGATTATCGCTAGAGAAAAAGCCTG[C/A]AGTGCTGTGCAGAAACGACGCATACGAGCTATTCTTCCAGCGCCATCACAGAACAGTGAGCTAAACTCCTTTAGCAAATACAAACTGGCTTGAGAAACTGAATGAAGAGCATGCGAGATGCTGACTTGTGTCTGTTTCTCTACAGATTCAGCCAGTCAGCCTGCGGTGATGCAGTGGATCACCATTCCTCCTGATAAAGTCAAAACAGACGCTGGTATCATGAGAGCCGGTGAGAGAGAGGAATGATGACGCAGAGGTTTATGTTTGCTTCATCGCTGACTCTCTTGTAATGTGTTGTGTTTGTTTGGTTTTTCAGTGAAGGTCAGCGAACAACACATGGCAGGTCTGAAACCCAGCACTCTCAAACAGCTGGGTCACATGATCACACCCGCTGCTTTGCAACAGGTCAGCTCATCAATAAATCCCAAGTGAAGAGTGTTCATTCATTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCCGGGGTCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 731 1222 14 20
Genomic Location (Zv9):
Chromosome 14 (position 3072597)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2842937
GRCz11 14 3094054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTCAGCATTTAAGCATTACTGCAGTTTGTGTGTTTGTATTCTCAGGTT[T/A]GTTTAATGTCGGAAATAAACTCCTGGTGACGCTGGATTTGTTCTTTAAGA
Long Flanking Sequence:
TTATTTCGGCTTCAATGAAGGCAGTTATTAATATTTTAAAAACCAATTTTGGGACAAAATTATTAGCGCCTTTAAACTAATTTTTTTCTGATAATCTACATAACAAACCATCGTTATACAATAACCTGCCTAATTATACTAACCTGCCTAGGTAACCTAATTAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCTGTATAGAAGTGTCTCGAAAAATATCTATTCAAATATTATTTACTGTCATCATAGCAAAGATAAAATAAATCAGTTATTAGAAATGAGTTATTAAAACTATTATGCTTAGAAATGCGCTGAAACAATCTTCCCTCTGTTAAACAGAAATTGTATTATATAAATGAAAATAAAAGTACAGCAATACCTCAATGTTACTAAAATCACACATTACTATAAGCATTAATTGTAACACTGAGAAGGCAACATGTTCATGTATCTCAGCATTTAAGCATTACTGCAGTTTGTGTGTTTGTATTCTCAGGTT[T/A]GTTTAATGTCGGAAATAAACTCCTGGTGACGCTGGATTTGTTCTTTAAGATGAGGAATCAGATCCGACTGGGGGACGAACCTGCTCAAGCTGCTCTCAGTATCATCACAAACGCACAGACAGGTGCTTCCTCATCTTTATACACTTCTGCCTAAAAGCAGCAGTAAGATTTTTGAATATTGTAATCCATGCCTTTAAAGGGAAACTAATAAATCACTTCTTATAAGGGGTTAAAACACAGTTGTGTGGCAAAAGTGTATGTACATAACCAGCTTCTCATGGTAAAAGTGTATAAATTGTATTATTTATACCCACACGTCTGCAGAAACGCTTTGATTGTGTATTTAGTGTTCCTTGTGTGTTTTTTAGACGGTGTGTTTACATCGGATCAGACATCTCGTATTCAGGAGCTGTTCTGCAGTGGTTTCTGGGCATTTGAGTGTCTGACGCTTCGAGATTATAACGACATGATCTGTGGCATCTGCGGCATCGCTCCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9952
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 1038 1222 19 20
Genomic Location (Zv9):
Chromosome 14 (position 3065760)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2849774
GRCz11 14 3100891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGTGGCAGACTGTGCCCAGAAGGTGGCGCTCTGTGCTGAYGTGTCCTA[T/A]CCTCAACTCGCCAAACAGATGTGGGGGGAAAACCAGGGCTGTTTCTCTGA
Long Flanking Sequence:
CATGTTCTCCCCATGTTGGCGTGGGTTTCCTCCAGGTGCTCCGGTTTCCCCCACAGACAAACACATGCTCTGTTGGTGAATAAAAAAAACTAGATTGGTCGTAGTGTGTGAGTGTGTGTAAATGAAAGGGTGTATGGGTTTTTCCCAATACTGGGTTGGGAAAGGGCATCTGCTGTATAAAACATATGCTGGAATAGTTGGCGATTCATTCCACTGTGGTGACCCCTGATAAATAAGGGACTTAGCCTAAGGAAAATAAATAAATGAATGAATGAATGAATTAAAAAAATTACACTAATGAAGAGTCCTCATAAAGCACAAAAACAATTATGTGTGTGTGTGTGTTTGTCATCTGCACAGGTGGTTTGCGGCTCGAAGTATATCGTGCGCAGAGAAAGTGCTCGCGATCACTTGGACCTGCTGCTGTCCTCCAGATTCTGGCCGCCAGTGTATGTGGCAGACTGTGCCCAGAAGGTGGCGCTCTGTGCTGACGTGTCCTA[T/A]CCTCAACTCGCCAAACAGATGTGGGGGGAAAACCAGGGCTGTTTCTCTGATCCCACAGCAGCTCCACAGGTCAGAAAATAATAGTATTATACTCTGTTACATTTTAAAGTGTTAAACACAAATATAAAGGAGTATATTATTAAGTTGTATTGATGTTAGTAATTATTATAATTTTTTACATTAGTATAGTTCATGTGAAATGATTATAATAGTTGTCAGTGTGCTGCAGTTTTCTTTTTTAAGAACTAAAATGTTTTTAAAATAGTGTATATACATTATGCATTAAATAAATCTAATAATAGCAATTATCATATTTATTAATAATAACATCATATAATTTTTTTTTTCTGTCCTCATTCCAGACAGGTCTGCTTTTGTTTCTTTGATTGAAAATCAAAAACAAATATTTTTAAATATTGAATTAACATTACATATTAAAACTATAATAACAATATTATTATTATTATTTAATATCATATTGTAATTTGAAACTGTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10782
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110721 Nonsense 1062 1222 20 20
Genomic Location (Zv9):
Chromosome 14 (position 3063881)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2851653
GRCz11 14 3102770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RCACAACCATCTCAACAATAATWWTGCACATCTCCTGTTGTGTTTCAGTA[T/G]GTCTCSTGCTCRGAGCTCCAGGATCAGCCATACAGTCTGGACCTCACCGT
Long Flanking Sequence:
GCCTAGGCGCATTTCAAGGTTCGTTTGACAAGTGTGAGTGCTCCGAATCAGGCCCAGGCGTGGCTCAGTTGGCCGGCCCTGGCCCGGTTGGAAGAAGTGTGCCAGAGCAAGGTTCACTTGGGCCCAAAACCGAAGATGCAACATCACTTGTTTCATTAATCATTCTTACTGTTCAATAAACACAAACTGTCGTAGATTATTAAAGATGCACGCTTCTCTTCTGTTAAATTGAGCAGCGCATCAATGATGTTGTAAGTGTGCTCCAGCTCGGTTGCAATGTGAGTGCAGACCGTGGGGGAGATGGGAGGGGGGCATGCGTGCTTCAGCATGATTCAAGTCAACTGTACATAGTGTGAGTACGCCCTAAATGACTTTGAATGTGGCTAGTTGTTGGTGCCAGACGGGCTGCTCTGAGTATTTCAGAAGCTGCTGATCTACTGGGATTTTCACGCACAACCATCTCAACAATAATTATGCACATCTCCTGTTGTGTTTCAGTA[T/G]GTCTCGTGCTCAGAGCTCCAGGATCAGCCATACAGTCTGGACCTCACCGTGACCGACTCCAACCCTCAGCTCCACCCGCTCACCAAATCCACCTCCCGCTGGATGGTACGACCCGACACACCCACCTCCACCCTCAAGGACGCCCACTACAACATCAGCCTATGTAGAGAATTGGAGCCCTACGCCAGCCTGAGCGCCCAGATCTGTGAGCCAAACAACCACAAACCAACGCAAGTGTTCCAGAACGCAGCGTATTATTACCTGTACAACCGTCTGCTGGACTTCCTGAGCAGCAGAGACATCGTGAACCAGCAGATCACAGACGTGCTGAGCTCCTGCCAGCCTGGAGAGGTGCTGATGATCAGAGACGCCCTTTACAGACTGGGCATCGCTCATGTTAACACTGAACAGGAGGACGAGGAGGATGGAGGACACGCACACACTGATGGGGTAGTAGAGCTGGAAGAGCTGATGCTCGTCTGATGCAGGTTTACGTACAC
Associated Phenotype:
Not determined