Busch Lab

ZMP

LOC571586

Ensembl ID:
ENSDARG00000077805
Human Orthologue:
JMJD1C
Human Description:
jumonji domain containing 1C [Source:HGNC Symbol;Acc:12313]
Mouse Orthologue:
Jmjd1c
Mouse Description:
jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa23163 Essential Splice Site Available for shipment Available now
sa11990 Essential Splice Site Available for shipment Available now
sa44877 Nonsense Mutation detected in F1 DNA Not yet available
sa10357 Nonsense Available for shipment Available now
sa42990 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36501 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14737 Essential Splice Site Available for shipment Available now
sa32173 Nonsense Available for shipment Available now
sa17049 Essential Splice Site Available for shipment Available now
sa42989 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23163
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 106 2603 3 27
Genomic Location (Zv9):
Chromosome 17 (position 43805191)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12943964
GRCz11 17 43760121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGTCTTGTATCGAGATGGACTGATTGGTTGTGATATTTTGTTTGACA[G/T]AAATTCCGGCCTCTGATTGGTCAGTCATGCGTGGGAGGCCTGTCTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11990
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 313 2603 8 27
Genomic Location (Zv9):
Chromosome 17 (position 43767143)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12981918
GRCz11 17 43722167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGAAAAAGAAGGAATGAGGGAGGAAAAGAGGAGTGATGAGRGAARAG[G/A]TGAGTTGGAGCTGTAGATAATGATTATGAGGATGTTAAAAGCACTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44877
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Nonsense 603 2603 9 27
Genomic Location (Zv9):
Chromosome 17 (position 43766082)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12982979
GRCz11 17 43721106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATCTCCAGCAACTGTAAACACAGAATATGGATCTGAAAGTCCTTGCTG[T/A]TCTCCTGAGACCATAACTAAACCACAGATCATTCGGGAGGTGTCCAGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28916
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Nonsense 950 2603 11 27
Genomic Location (Zv9):
Chromosome 17 (position 43762973)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12986040
GRCz11 17 43718045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAACTCTTCTGCATTCATTTTTGATGTTCTTGTTACCAGAGAGCTGGAC[A/T]GAAGAGGCATAGCTGAGAGCACATTCATCCACTCTCACCTCAAGTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10357
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Nonsense 1463 2603 11 27
Genomic Location (Zv9):
Chromosome 17 (position 43761434)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12987579
GRCz11 17 43716506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTCCCTCATTTGAAAAAACACAGAGCTGGACTAACTGCTGCTATCTCT[A/T]GAGCTAACACACATACAATTCAGCCTCAACACACTACATATCCTTTGMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42990
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 1937 2603 13 27
Genomic Location (Zv9):
Chromosome 17 (position 43759375)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12989638
GRCz11 17 43714447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCGTAAAGACAGAGGACACTGCATACTCATGGGTCAAGAAAGACA[G/A]TACGTTTGTGTGGAATGACAGACACAGTTTCTTATTGCTTGTCATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36501
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2019 2603 16 27
Genomic Location (Zv9):
Chromosome 17 (position 43756493)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12992520
GRCz11 17 43711565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACTGGGAACCTTGTAGTAATAAGCAATGCATTGTCATTTGTCCACAA[G/A]TGTTGGCGGACATGCAGAACTCTTTGCACTCTTTGAAAGAAAAGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14737
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2089 2603 17 27
Genomic Location (Zv9):
Chromosome 17 (position 43756086)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12992927
GRCz11 17 43711158
KASP Assay ID:
2261-1479.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGAAGAACTCACAGCACGTCACACTGAGAGCGCACACTGAGAGAAGAG[G/A]TAATGACAGWAGTAATGCGCAATAATACGCTAAGATATTTTTCACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32173
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Nonsense 2179 2603 19 27
Genomic Location (Zv9):
Chromosome 17 (position 43753576)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12995427
GRCz11 17 43708658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATAAGATTCCCGCTACAAAGATGGCCAAGGCAGAGCTCAAACAGGATT[C/A]GCTGCCTGAGGAGGAGGCGGGGCAGCGGCCAGATGGAGTAAAGCTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2295 2603 20 27
Genomic Location (Zv9):
Chromosome 17 (position 43752979)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12996024
GRCz11 17 43708061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCAACTCCAAAGTCAAGGAGTTCTGGGAYGGTTTTGAAGATGCCTCAA[G/A]TGAGTGATCCAGTTTAGCAATTCTGCGCTCATCATTTKTAATTTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42989
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114523 Essential Splice Site 2411 2603 24 27
Genomic Location (Zv9):
Chromosome 17 (position 43751477)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12997526
GRCz11 17 43706559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTGAACCATAACATGTCTTTCAAATTCGGTTGTTAAACTCTGTGTTA[G/A]GTGTATTGAAGCTCTTGGAGGAGGAAGTTCTGGATGAAAGCGTGAAGAAA
Associated Phenotype:
Not determined