Busch Lab

ZMP

A4IGG8_DANRE

Ensembl ID:
ENSDARG00000077804
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A4IGG8]
Human Orthologue:
HGSNAT
Human Description:
heparan-alpha-glucosaminide N-acetyltransferase [Source:HGNC Symbol;Acc:26527]
Mouse Orthologue:
Hgsnat
Mouse Description:
heparan-alpha-glucosaminide N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1196297]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17427 Essential Splice Site Available for shipment Available now
sa19454 Essential Splice Site Available for shipment Available now
sa32629 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 223 643 6 18
Genomic Location (Zv9):
Chromosome 1 (position 13959575)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14546361
GRCz11 1 15232874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTATTCGCTTGGGGGGAACAGTTGAGACAGAGAGGCTGATAAACTCGG[T/C]AAAAATGGCTTTAATACATTTATAATRCTACCCCTAATACTGTGTGCTTG
Long Flanking Sequence:
CATGTTTAGAAATGTGTTCTCTTCTCTCTGGTAAACAGAAATTGGGTAAAAAATAAACAAAGGGCTAATAATTCAGGGGGGCAATAATTCTGACTGCAACTCTATAATGATGCAAATGAGGCATAAAAGAATTGCTCAAATTAAATGAAGTAATTCGAAGGGAAAATAAATCTGTTAAATAATTTATTTATTCACTTGAGCTTGAGTAAATCTGTTTTCTTTTTCTTTTTTTAGCTATTCTGTTTGCTTTTCTGGTGTTTGCTTTTCTGGCTGCATTATCAGCAATCTGGAGCACAGTTAAAAGGTAAACCCATCTTTAAATATTTTTTACTCCAAGTAATAATGACATTTAAACAACCCCAGAACACCTTGTTGTAACCATTCTAGTTTGAAAGCTTTTAAAAACAGAGTTTTTGTGGCATTTTTAAGGCTGGATGCTGTGACAAATCTACTTATTCGCTTGGGGGGAACAGTTGAGACAGAGAGGCTGATAAACTCGG[T/C]AAAAATGGCTTTAATACATTTATAATGCTACCCCTAATACTGTGTGCTTGATTTTTCACTTTTTGAACTTAAAAAAAATGCAATGTTTTAAATATAACACCACACTTGATTCAGTGTTTTTGCAGGTTTCAGGTGAGTGTGAAAAATTACAGACATGATAAGGAATTTTTATGTTTTTTTCTCTCTCATTAATTCAGACTTTCTCACTCCCTTTTTTTCCTCCCTTCATCTCCAGGAGCTTGGCACTCCAAACAGATTGGTAGATGCCTCCACGGAATCGATAATTCCTGCCACTACAGGACGGAGGCTTCGTTCTTTGGATACTTTCCGTGGGTACGATGCTCTTTCGCTAATTGTTTCAGGTCCAATGCTCTTGAGAAGGGAATTGAAAATTTCAGGTGCAAATGATCTCGCACAGAATCTACTATTTTACATACCGTGGAGCTGGTTGTCAGAATTTAATTTGCATTTCATTTATTATTATCCCGAAATAGAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19454
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 425 643 12 18
Genomic Location (Zv9):
Chromosome 1 (position 13969159)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14555945
GRCz11 1 15242458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCTGGCTGTGTTTGACCTTCCTCCTCCCAGTGCCTGGCTGCCCAACG[T/C]TAGTACAGTCTTATTCATGATATGAATGCATCATATTTTCAGAGCTGTCT
Long Flanking Sequence:
CTATTTGCATTTTAAACTTTTTAAATTTAAATATAATGTTTTTCAAAACTAAATCTTATACTATTGATTGAGACATATAAAATAAAATTAATTGTGATTTTCCAAAAAATATTGGATATTAATGTTAAATATTAATATATCCAAAAAATATTATAATTGTTTTTCAGCATATTTATTTTTTGCTTATTTTTGCTTTACTGACTGCACAACCATAACCTGTACTACTACTACTTCTACTAATACTATTACTACCAGTACTATCACTACTACTATAATAATAATAATAATAATAATAATAATAATAATAAAAAAAATGAAATAATAATAATAATAATAATTGTAATTATTTCAGTTTTGCATCGTCTTGTCATTTCCAGGAAACATGCTGGTATTGGGTGCATGATATCTGCCTCTACTGGCCCGCATGGTTGTGTGTGATTATCCTCGAGACGGTCTGGCTGTGTTTGACCTTCCTCCTCCCAGTGCCTGGCTGCCCAACG[T/C]TAGTACAGTCTTATTCATGATATGAATGCATCATATTTTCAGAGCTGTCTATTCCCATATTCCTTACCTTATTTGCAATTACAAAGGGAACCTTCTGAAGAAACGACTGTTTTTCTGTCTTGTTAAAATTATAGGACATTTGCATAGATATCAGCAATGCCATATTAGAAAGAATAGATTTGACAGCCTAATGCAAAACATATTGTTAAAAAGCATTGGTAAAATATCAAAATGGAAAAACAAAAGAAATCTTTTACACATTGCAATTTACATGGTTTAATGTAACCTTATTAGTCAGTTGTATTGGATGGATGTATGCCATGTAAATGAAAATGAATATGCAAATGAGAGCATTTTGAAAAGAATGACTCACGCCTATCTGTTTGCTATTCATGATGCACGTCTTGTGTGGAAATTGCTATTTATGCTTTTGGCTTCTCTCTCCTGCAGTGGTTATCTGGGTCCAGGGGGCATTGGGGACTTTGGCCAGTACCAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32629
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Nonsense 534 643 16 18
Genomic Location (Zv9):
Chromosome 1 (position 13976049)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14562835
GRCz11 1 15249348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTGTTTACATTAAGGGGATCATCTCAGCTGTATTGACCAAGTGCTCC[A/T]GAAATGATGGCTTCATCCCTGTCAATAAAAACCTGTGGTAAACAAAGTCT
Long Flanking Sequence:
TGACCAGCATTTTGTGATAAAGATGTGATTATGCATCATATTGCATGGGATTTGGCCAAATAGCTTTATAAATGGACATGAAAAACTGATTTGAATTGATATGATTTTATTGTGTGAGCAGGAATAAAGACCATAGAGAAACATTAAATTGGCACAGTCAAGTAGAAAATGAGAAAAGCGGTCATTTTCACACTGTAGGAGTCATTATGCACACATATTTCAACACATATTGCTGTGACTGACTCATAACAATCATGTGTTTCAGAAAGTTGTGTAATAATGTTTGTAATTGATATTAAGTGTGCATAATGTTATTAGGGATGCATTAGATGGGTTCTATTCATTTAACTTTTCACAGTTTCATTTTTTTTTACTGCCATCAGAAGATTCCAACACACTTTGAAAGTCATACTGTAAATCAATATTAATATACAGTATGGATTTTTTTTTTAACTGTTTACATTAAGGGGATCATCTCAGCTGTATTGACCAAGTGCTCC[A/T]GAAATGATGGCTTCATCCCTGTCAATAAAAACCTGTGGTAAACAAAGTCTCTCTCAAACATTTCTGTAGTTTTATTTGATATTACTATTAACATTACTTGGTATTGATTTTGTGGTATAAGTATATCTTTTTTAAAACATGAAAGTTTGCTCAAATGCAGTTTCATGAGCATTAAATATAAAATAATTGTGCATTTGTCTCTTGTTTTAGGTCTTTGTCGTATGTGACCACTCTCAGCTGTTTTGCTTTTGTGGCTCTGGTGTTTTTTTACTACACTGTGGATGTAAAGAAGTGGTGGTCTGGAGCTCCCTTCTTCTACCCTGGTAAGCTCAGATGTTACAAGTGTTACAATATTTCATTGTATTTGAAGTGTTGTATCAGATGCAAGTTTTTTTCCAATATGGATTTTATAAAATAAGTGTAACAAGCCATGAACTAAATCATGCAGTACATTACAAACTTTTTTCTGACAGTCTACCCTCAATTAACAACCTTAAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25546
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109911 Essential Splice Site 584 643 17 18
Genomic Location (Zv9):
Chromosome 1 (position 13976374)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14563160
GRCz11 1 15249673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGGATGTAAAGAAGTGGTGGTCTGGAGCTCCCTTCTTCTACCCTGG[T/G]AAGCTCAGATGTTACAAGTGTTACAATATTTCATTGTATTTGAAGTGTTG
Long Flanking Sequence:
TTAGATGGGTTCTATTCATTTAACTTTTCACAGTTTCATTTTTTTTTACTGCCATCAGAAGATTCCAACACACTTTGAAAGTCATACTGTAAATCAATATTAATATACAGTATGGATTTTTTTTTTAACTGTTTACATTAAGGGGATCATCTCAGCTGTATTGACCAAGTGCTCCAGAAATGATGGCTTCATCCCTGTCAATAAAAACCTGTGGTAAACAAAGTCTCTCTCAAACATTTCTGTAGTTTTATTTGATATTACTATTAACATTACTTGGTATTGATTTTGTGGTATAAGTATATCTTTTTTAAAACATGAAAGTTTGCTCAAATGCAGTTTCATGAGCATTAAATATAAAATAATTGTGCATTTGTCTCTTGTTTTAGGTCTTTGTCGTATGTGACCACTCTCAGCTGTTTTGCTTTTGTGGCTCTGGTGTTTTTTTACTACACTGTGGATGTAAAGAAGTGGTGGTCTGGAGCTCCCTTCTTCTACCCTGG[T/G]AAGCTCAGATGTTACAAGTGTTACAATATTTCATTGTATTTGAAGTGTTGTATCAGATGCAAGTTTTTTTCCAATATGGATTTTATAAAATAAGTGTAACAAGCCATGAACTAAATCATGCAGTACATTACAAACTTTTTTCTGACAGTCTACCCTCAATTAACAACCTTAAAGCTCAGTGTTTTTGTCACTCTCTGCCTTTATTGTTTTTAGTGTGTCTATTTAAAGAAACAGTCAGCTTATTTAATAATATTGTGCAGCGCTCTGGATAAAGGCTTAATGTGTACTAGGGCAGTAAAATATCAGGGGAGAAATGTCAATTGTGATATCTTGTTTTCTGCAATATGTATTTGCAGTATAACAGTTTCATTAGATGTCTTATAGTAATCATTATAAAATATTATATTATAATTCAATTAAGGGCTGTCACAGTGATGCAGTGGGTAGCACGATCGCCTCACAGCAAAAAGGTCGCTGGGTCAGTTAGCGTTTCTGTGTGG
Associated Phenotype:
Not determined