Busch Lab

ZMP

BRSK2 (1 of 2)

Ensembl ID:
ENSDARG00000077791
Description:
BR serine/threonine kinase 2 [Source:HGNC Symbol;Acc:11405]
Human Orthologue:
BRSK2
Human Description:
BR serine/threonine kinase 2 [Source:HGNC Symbol;Acc:11405]
Mouse Orthologue:
Brsk2
Mouse Description:
BR serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1923020]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9674 Essential Splice Site Available for shipment Available now
sa41001 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6150 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9674
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Essential Splice Site 117 675 4 19
Genomic Location (Zv9):
Chromosome 7 (position 50833263)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49103499
GRCz11 7 49376275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCAAGCTTKGGTGAGACAMATGATGARATATTGTCTTGTTTTCTTGCA[G/T]ATCCCCTCACTATGCCTGTCCAGAGGTTATAAGGGTAAGTATGTGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41001
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Essential Splice Site 349 675 10 19
Genomic Location (Zv9):
Chromosome 7 (position 50812390)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49082626
GRCz11 7 49355402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTTCCTGTGAGACGCGCCATCGACATGGCACAACACGGGCAGAGG[T/C]ACAGCCACACATCTCCCGCTCCTCTATTATTTACAAAAATCTACAATCGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3633
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Nonsense 581 675 16 19
Genomic Location (Zv9):
Chromosome 7 (position 50793302)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49063538
GRCz11 7 49336314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAACGGGTGGTGGAGACGATTCAGGCTCAGTTGTTAAGTACACATGAC[C/T]AGCCTGGTGTCCAGCAGCTGTCTGGTGAGTGGTCAATCTCTMCACTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6150
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109147 Essential Splice Site 605 675 18 19
Genomic Location (Zv9):
Chromosome 7 (position 50784346)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49054582
GRCz11 7 49327358
KASP Assay ID:
554-3679.1 (used for ordering genotyping assays)
KASP Sequence:
AYCCAGTGAAGATCACAGATCAGATGGAGACACAGAGACTCACTGCCACA[G/C]CAAGACCTTRGAACAATAAAACAGCTGCACTGTCGAGCCTGCCGATGTGT
Associated Phenotype:
Not determined