Busch Lab

ZMP

adamts9

Ensembl ID:
ENSDARG00000077778
ZFIN ID:
ZDB-GENE-070814-6
Human Orthologue:
ADAMTS9
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 9 [Source:HGNC Symbol;Acc:13202]
Mouse Orthologue:
Adamts9
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 Gene [

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa41811 Nonsense Mutation detected in F1 DNA Not yet available
sa9181 Nonsense Mutation detected in F1 DNA Not yet available
sa9314 Nonsense Mutation detected in F1 DNA Not yet available
sa17633 Nonsense Available for shipment Available now
sa41812 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30656 Nonsense Mutation detected in F1 DNA Not yet available
sa35066 Nonsense Mutation detected in F1 DNA Not yet available
sa18108 Nonsense Available for shipment Available now
sa41813 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41811
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 3 1443 1 28
ENSDART00000138964 None None 1405 None 27
Genomic Location (Zv9):
Chromosome 11 (position 19578486)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18995800
GRCz11 11 19158142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCGGGCTTGCTTGCATTCATTTTTTCTAAACGTGGACAATCATGGTTT[T/A]GTTCTCCTGGGGAATTAGTTTTTTAGTATTACTCTCTGATCTAATGAATG
Long Flanking Sequence:
GTATTATTACGTGTTACGTTATTATTACATTAGATAATCTCTGGACTGAGGCAGTGTGCTTATCTAACTTATCCAACTGAATGTTCAAACATAACAGCACAATCTGAAGTAGTTACGAACATAATGCACGTGTGCGTGATGATTATGAGTAACATGTTCAGTGATTTTAAAAGTTTAGTCTGCACGCTACATTAGCGACACATATGGCAGGAGTGGCTTTCTGAGAGGGGTGTCTCTAAGAGTACGCCCAAGTAGGCTAAAGTAATCAGCAAACTGGAGACCACCACAGTTGCATCGACCCCCTTTCTGGTATTATGCATGCAAACCAAGAGCTCCGACCGAGCGCTTGTTTAGCGACATGGAAGTCACTTCTGTAAAGTAGAGGAGAAACGCTTTGGATGCAGCAACCGTGCGGCGAAAGCCCGGCTTCAAGGGACAGCGGAATACTGTATTCGGGCTTGCTTGCATTCATTTTTTCTAAACGTGGACAATCATGGTTT[T/A]GTTCTCCTGGGGAATTAGTTTTTTAGTATTACTCTCTGATCTAATGAATGCACTAGCTTCAACGGGGAGACTGCGAGGTTCAGAAAAAGGTACGTGCTCTTTTCACGATCGTTTACTCTCTCATTCAACTCAGTACTTTGAGGCGCGGAGAATGAATGACTTTCCTTTACTTTCCTAACAGTTCATAGCGCGCTGTCGAAGATTTCGAGTAATGCTTTCAGAAGTCTGACTGACACCTGATTTACCATGTGGAGTCTTAGAATGAAGTCCAGTTTAATGAGGATTTGTACATTTTTACTTACAGTATGGGCTATATCAGTTGACAAAATGAATTATTAAAAAAAAACTTGAAGTCATCAATTCTGTTACAGTCAGTGGTATAAAATCCCATTTAAGCGAAGATTTAATTCAAGTGAACCCTTATGGACAAGTCGAAGTGCCATTTTTGTCAGTTTGTTTAGTTTATCGTTCTCTTATTGTCAGGCACGTTACAATGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9181
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 28 1443 1 28
ENSDART00000138964 None None 1405 None 27
Genomic Location (Zv9):
Chromosome 11 (position 19578560)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18995874
GRCz11 11 19158216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTATTACTCTCTGATCTAATGAATGCACTAGCTTCAACGGGGAGACTG[C/T]GAGGTTCAGAAAAAGGTACGTGCTCTTTTCACGATCGTTTANNCTCTCAT
Long Flanking Sequence:
AACTGAATGTTCAAACATAACAGCACAATCTGAAGTAGTTACGAACATAATGCACGTGTGCGTGATGATTATGAGTAACATGTTCAGTGATTTTAAAAGTTTAGTCTGCACGCTACATTAGCGACACATATGGCAGGAGTGGCTTTCTGAGAGGGGTGTCTCTAAGAGTACGCCCAAGTAGGCTAAAGTAATCAGCAAACTGGAGACCACCACAGTTGCATCGACCCCCTTTCTGGTATTATGCATGCAAACCAAGAGCTCCGACCGAGCGCTTGTTTAGCGACATGGAAGTCACTTCTGTAAAGTAGAGGAGAAACGCTTTGGATGCAGCAACCGTGCGGCGAAAGCCCGGCTTCAAGGGACAGCGGAATACTGTATTCGGGCTTGCTTGCATTCATTTTTTCTAAACGTGGACAATCATGGTTTTGTTCTCCTGGGGAATTAGTTTTTTAGTATTACTCTCTGATCTAATGAATGCACTAGCTTCAACGGGGAGACTG[C/T]GAGGTTCAGAAAAAGGTACGTGCTCTTTTCACGATCGTTTACTCTCTCATTCAACTCAGTACTTTGAGGCGCGGAGAATGAATGACTTTCCTTTACTTTCCTAACAGTTCATAGCGCGCTGTCGAAGATTTCGAGTAATGCTTTCAGAAGTCTGACTGACACCTGATTTACCATGTGGAGTCTTAGAATGAAGTCCAGTTTAATGAGGATTTGTACATTTTTACTTACAGTATGGGCTATATCAGTTGACAAAATGAATTATTAAAAAAAAACTTGAAGTCATCAATTCTGTTACAGTCAGTGGTATAAAATCCCATTTAAGCGAAGATTTAATTCAAGTGAACCCTTATGGACAAGTCGAAGTGCCATTTTTGTCAGTTTGTTTAGTTTATCGTTCTCTTATTGTCAGGCACGTTACAATGATACTAAAACAGATATTTATAGAAATATCAACACTTGTGACTTAGCGTTTCTCTTTTAATGACAGTAAAACTGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9314
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 275 1443 4 28
ENSDART00000138964 Nonsense 241 1405 3 27
Genomic Location (Zv9):
Chromosome 11 (position 19585383)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19002697
GRCz11 11 19165039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAGCAGTGACTCCAAGCCACACCGGAGATCAAAGCGTTTCCTCTCCTA[C/A]CCCCGTTTTGTTGAAGTCATGGTTGTGGCAGACAGCAAGATGGTGGAACA
Long Flanking Sequence:
GTTGGAATGTAGACGCTATGTAACTTAAAATAAACAAACGGACCATCAAATTAAAGTGTGACCTCAAATATTAACAATTTGCTCGGACACATACCTAATAAATCAAGTAAATAGAGAGAAACTTAACATTTTCAAGTGGTCTCTTATTTCTTTACATAGCTGAACACATGATCATGAATACATTCATCCATGGTTACCATTGGATGTGAACTTGTGACATATAATAAAGGAAGCAGTAGCCCTCATGGCTAAATTTGACTTTCTTGTAATAAAATAACTTAAATTCATTTAAATGCATTGTTCTCTTCTTCATCTGCAGGACATACAGAGCCAAACCGCAGACACAGGAACAGACTGAAGAGAAAGTCGCCCTCCAGCATGCTGTCCGACCTGGAGACTCTTAATTCCAGACTCTTCCCCTTCTCAGAAAACAAGCACAACTCCGCTAATGAAAGCAGTGACTCCAAGCCACACCGGAGATCAAAGCGTTTCCTCTCCTA[C/A]CCCCGTTTTGTTGAAGTCATGGTTGTGGCAGACAGCAAGATGGTGGAACATCATGGAAGCAACCTTCAGCACTACATTCTTACCCTGATGTCCATCGTAAGTTACGGCCAGTTAACGATAGTCTTAATGGGTCTGTGTCCGTTGCTTTAGGTCAGGTTGTGAAGTGAATATTTCTGACAGGGTTTGATGCACATCAGTATAAAACAAATAAAATCAGGTATGTCGCATGCACGGCATACTTTAGATGCTTTTTAGTTGAAACTCGCTGGGAGCTTCGATGACCTATATTTTGATCTTGGCAAAGGCTGCATTCTCAGCAGGATCTGGCAGCGCAGGCCAGTTCTCAATGGCCAAGAAACATTTTTTCAACAGCTGAGGTTAATGTCGCGTGTTCAACCCTACTTAATAAGATAAATCAAAGAGGTTTGTGTGTATTGGAGTTAGTGAATGAGAAAAATGCCAGCTTTTTTGAGGCTGCAATGTAAAAACTGCTCTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17633
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 356 1443 6 28
ENSDART00000138964 Nonsense 322 1405 5 27
Genomic Location (Zv9):
Chromosome 11 (position 19588074)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19005388
GRCz11 11 19167730
KASP Assay ID:
2260-4159.1 (used for ordering genotyping assays)
KASP Sequence:
CTATCTCCTTCAAWGCACAAGCCACTTTGAAAAACTTCTGCATATGGCAG[C/T]AAAGTCAAAATCACCCTGATGACAACCATCCCTCACATCACGACACCGCC
Long Flanking Sequence:
TCACCCCAAACTTTTGAAAAGTATACTACAATATATAACAACATGCTGTGAAACCGTACCATGGGATACAATTAAGGGCCAAAAATGGTCAGATGTAAGGATAAACTGTTGAAAGCTAAATCTCTCAGGCTGACAGTTTGAGGCCCCTGTTGTAAAGTAATTAGATCCTTTGATAATGAATTCCAATTGTCTGTATTCCTTTGCTCAGGTTTCCTCCATCTATAAGGACCCCAGCATTGGAAACCTGATTAACATTGTTATTGTGAAGCTGGTCATTATAAAGAATGAGCTGGTAAGAGTTCCCTTTGTGTGGTTTAAAGGAAGTGTCTTAATTAACAGCTCTTTTAAATGTGCTTAAGCAGTTCTTTACAGTCGAGCCCTAATCGTTTCCACAAGGCTAAATGTATATTTCAGTAACATCTGTCTCTATTCCCCTGTAGGATGGACCCACTATCTCCTTCAATGCACAAGCCACTTTGAAAAACTTCTGCATATGGCAG[C/T]AAAGTCAAAATCACCCTGATGACAACCATCCCTCACATCACGACACCGCCATCTTAATCACAAGGTGAGAAATATTCATATGCTTTCTTACCCCTTTTTATTGCTCACTTGTGTTGTAGAATACTTAGCATAGATAAAGATGGTTGATGTTATGTGTCCTCCCTCCACATGTATTTAGAGCCGTTCACTGAACACTGAAACTTTATACTTTGTGTAGGCGATGAAAGCTAAATAAAAGTTTGACTTTTCAAGGCCACAAGAGCAGAAAGTAGACAATAATGTGGACAACATATACACAAATGTAAGATCAATTGTGTATGTAAGTACTGCTTAAACTAGTCCTGTTTTCTTCTTTTCTTTTTTAGGCAGGACATCTGTCGAGCACGGGACAAATGTGACACTTTAGGTAAAAAGTTTGATTATGATCACATTACAGTTGACAATAGGGCTTTATACTCTCAGAATGTTTAATTAGGAACATTCTAAACTCCATGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Essential Splice Site 377 1443 6 28
ENSDART00000138964 Essential Splice Site 343 1405 5 27
Genomic Location (Zv9):
Chromosome 11 (position 19588139)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19005453
GRCz11 11 19167795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGATGACAACCATCCCTCACATCACGACACCGCCATCTTAATCACAAG[G/A]TGAGAAATATTCATATGCTTTCTTACCCCTTTTTATTGCTCACTTGTGTT
Long Flanking Sequence:
ATACAATTAAGGGCCAAAAATGGTCAGATGTAAGGATAAACTGTTGAAAGCTAAATCTCTCAGGCTGACAGTTTGAGGCCCCTGTTGTAAAGTAATTAGATCCTTTGATAATGAATTCCAATTGTCTGTATTCCTTTGCTCAGGTTTCCTCCATCTATAAGGACCCCAGCATTGGAAACCTGATTAACATTGTTATTGTGAAGCTGGTCATTATAAAGAATGAGCTGGTAAGAGTTCCCTTTGTGTGGTTTAAAGGAAGTGTCTTAATTAACAGCTCTTTTAAATGTGCTTAAGCAGTTCTTTACAGTCGAGCCCTAATCGTTTCCACAAGGCTAAATGTATATTTCAGTAACATCTGTCTCTATTCCCCTGTAGGATGGACCCACTATCTCCTTCAATGCACAAGCCACTTTGAAAAACTTCTGCATATGGCAGCAAAGTCAAAATCACCCTGATGACAACCATCCCTCACATCACGACACCGCCATCTTAATCACAAG[G/A]TGAGAAATATTCATATGCTTTCTTACCCCTTTTTATTGCTCACTTGTGTTGTAGAATACTTAGCATAGATAAAGATGGTTGATGTTATGTGTCCTCCCTCCACATGTATTTAGAGCCGTTCACTGAACACTGAAACTTTATACTTTGTGTAGGCGATGAAAGCTAAATAAAAGTTTGACTTTTCAAGGCCACAAGAGCAGAAAGTAGACAATAATGTGGACAACATATACACAAATGTAAGATCAATTGTGTATGTAAGTACTGCTTAAACTAGTCCTGTTTTCTTCTTTTCTTTTTTAGGCAGGACATCTGTCGAGCACGGGACAAATGTGACACTTTAGGTAAAAAGTTTGATTATGATCACATTACAGTTGACAATAGGGCTTTATACTCTCAGAATGTTTAATTAGGAACATTCTAAACTCCATGTAAAAGTATTACACAATGCTTTTATTCAACAATTATCTTTTTTGTATAAAGTGTATATGGTCACTAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30656
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 422 1443 8 28
ENSDART00000138964 Nonsense 388 1405 7 27
Genomic Location (Zv9):
Chromosome 11 (position 19591916)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19009230
GRCz11 11 19171572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTATTAATGAGGATAATGGACTCAGTACTGCTTTCACCATCGCTCAT[G/T]AGCTCGGCCATGTGTGAGTACTGTTGGGTTTTTTGTGAAATACTGTGAAA
Long Flanking Sequence:
CCCAATTAACCTAGTTAAGTCTTTAAATGTCTTTTTAAGCTGAATACTAGTATCTTGAAAAATATCTAGTAAAATATTATGTACTGTCATCATGGCAAAGATAAAGGAAGCCAGTTATTAGAAACGAGTTATTAAAACTAATATGTTTATAAATGGGTCTAAAAATCTCTCTGTTTAACAGCAATAGGGGAAAACATACAGGGGGCTGATAATTCAGTGAGGCTAATAATTCTGACTTTACCTGGAGTAATGATTGCAATTGTGAAATGTTTGTTTCCTTGGCTTTAATAGTGTTTAGAATAATGTAAACCTGGATTAACACAAGGTGTAAAGCCCTAATGAGGATGATGCTTATGGCAATGATGTGAAATGCAGCAACATTCTGACTGCTTCCATTTGCACTTTCAGGTCTAGCTGAGCTGGGTACAGTTTGTGATCCTTATAGAAGTTGCAGTATTAATGAGGATAATGGACTCAGTACTGCTTTCACCATCGCTCAT[G/T]AGCTCGGCCATGTGTGAGTACTGTTGGGTTTTTTGTGAAATACTGTGAAATAAATGTGCTCATACTTTTCTTCCTTGAAATATATGACACTTTGCATGACATTTCGCTGTTCAGCACAATGTCTGTCTTGCATTTTTCATTTCTAAATGTGGCCTGAGTGTCCAAATTCTTTTTGGGGCAGTAATATCTCCTGCATTAACAATGATGTTTGTCTTATGAACTTTACCTGAGAGGAGCTTTTATTACACACAGATCTAAACCTTTAATCATTTATTCAAGTGATTATGTGAAAGGTCTACCTTTAAAACACTTTATTTCTTTCAAGGTCTAACAGTGTGTAAATTTCTTATTCGTCTTCAATAGCTTTGTTTCATTTTGTAATGTTTTGGGAAGATTTCATTGCCTCTTGTACAGCTTGATAACGGTGTGTCTATGTCTGATATGCAACTTCCCAAGGTTATTTCTGCAGAGAGCACTAAAGTATTCAGTTATACACTAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4417
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 455 1443 9 28
ENSDART00000138964 Nonsense 421 1405 8 27
Genomic Location (Zv9):
Chromosome 11 (position 19595033)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19012347
GRCz11 11 19174689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGATGGAGTCAAGAACCAGCAACATGTGATGGCYCCTACGCTCAATTA[T/G]TACACTAATCCCTGGATGTGGTCCAAATGCAGTCGGAAATACATCACAGA
Long Flanking Sequence:
GATACTGCTCCTTCAACAGACATTTAACTGACTATAAAAAACTTTGCAAGTACATTTCAACTTACACTAACTCTAACCCCAGCCTAACAGTCTACTTATAACCTAATGAGAATTAGTGGGCCATGTAGATGCAATGTAACTTAATTTCAATAAAATGTATTAAAGGGCCATCAAAATAAAGTTACACCCAGTTAATTATCTATATTGTATATACCAATTATTGAGCCTGATACTAAATATCAGCGCCTTTTACTGTTTTTCACTACTGCCTTTTTCATATGATCCTGGAGTAAAAGTGAAATTACCCGGTTTAAGCCGACTTTGCCAGTACTGTTTGTCCTGTACATGCTCATCATCTTGATCAGTTGCATGTGTGTGTTTGTGCGCACGTGTGTTTTCACTCATGGCCTTAGGTTCAACATGCCTCACGATGACAGTAACAAATGCAAGGAGGATGGAGTCAAGAACCAGCAACATGTGATGGCCCCTACGCTCAATTA[T/G]TACACTAATCCCTGGATGTGGTCCAAATGCAGTCGGAAATACATCACAGAATTCCTCGAGTATGTAAACCCTCTTTACACTCCATGCATTGACAGGATGTTGTTAAGCCTGTGATGTTGGCTCGAACTCTTCAAGTTGAGCACCACTTAGTGATTAATGTCCAGCATTAGCATGCGCTTGTTGTCCTCTAAACATTCTCAACTGAGATGAAAACTACGTCATCAGAAGCAAACTGTCACTTACTGAGAACATTTCTATTGTTTGTTGCTTGTTTGTTTTGCTTTCTTTTAGCTCATTTGTTTATCATTTCTCATTAGCACAGGGTATGGTGAGTGTTTGCTTGATGAGCCGGTTTCTAGGCCATACAGTTTGTCCCAGCAGCTGCCTGGACAGATATACAGCGTCAATAAACAATGTGAGCTGATATTTGGGCCTGGGACGCAGGTGTGCCCATATATGGTGAGAGGATCCCTCAGGGAATTGCTTAACATACTGACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35066
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 588 1443 12 28
ENSDART00000138964 Nonsense 554 1405 11 27
Genomic Location (Zv9):
Chromosome 11 (position 19603348)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19020662
GRCz11 11 19183004
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGAGTCCCTTTGGCACGTGCT[C/A]AAGGACCTGTGGAGGGGGAATCAAGATCGCTGTCCGCGAATGTAACCGAC
Long Flanking Sequence:
AAGCCTACTTAGGTTTGTGTTTGAAGTAACCTCGGAATCATTGACAACTTGTTTCAGGCAGTTGGGAATTGGTTCTTTCTTTTGCTAGACAAAAACTCCCTTTATTCCGCACTTTGATCTTTAAAACTTTGCAAACCAAACATAAAAAGGTAATATCTAAAAAAGAAAGGCTTAATTTTCTCCAGGTCGACTAAACAGTTTGTTGAAATGAAAGTAAATAAGTCAGTAAGATACACAGCTCAACCAACCACATGTTGACAAGGGATCTGACCAAAGCAAAAGACACTCTGAATTGTCATATTGTCTGTGTTTCAACATTCATTCTAGTCGGTGAACTTTATAACAAACAGCCAGTCATGACTAATTCTTCAATGATCTCATCTTTTCTCTGTTTGTTCATTGCTTGCAGCATTGTAAACATGGCCTGTGCATCCATAAAGAGCATGAATATGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGAGTCCCTTTGGCACGTGCT[C/A]AAGGACCTGTGGAGGGGGAATCAAGATCGCTGTCCGCGAATGTAACCGACCCGTGTAAGCTGCCGCTCTTTGTAGTCTTGCATCCTCACTGGACTGTGAATTGGCACCATGTTTCTCAATGTTCCCTGACAAATGGCAGCAGCAAAGCCATCCTGAAGAAGAACATTTTTCAAAAGAGACTGCATTTTAATGCAGTGGGTAGACTGGAGGCTTTGCTCTATTTTAATTGCAGTGAAACAGAAACAAGATCAAGAAAGCTGAAGAGATTTTCTAAGAAATATTTCCAGTGTAGATATAAGCTCTGAATGTGTTTTTTTCTACTGTAGGCCCAGAAATGGGGGGAAGTATTGTGTTGGACGCAGGATGAAATTTCGCTCCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGGAACAGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCAAATGTTCGCTGGGTGCCAAAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27761
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 608 1443 13 28
ENSDART00000138964 Nonsense 574 1405 12 27
Genomic Location (Zv9):
Chromosome 11 (position 19603679)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19020993
GRCz11 11 19183335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCCAGTGTAGATATAAGCTCTGAATGTGTTTTTTTCTACTGTAGGCCC[A/T]GAAATGGGGGGAAGTATTGTGTTGGACGCAGGATGAAATTTCGCTCCTGT
Long Flanking Sequence:
TGAACTTTATAACAAACAGCCAGTCATGACTAATTCTTCAATGATCTCATCTTTTCTCTGTTTGTTCATTGCTTGCAGCATTGTAAACATGGCCTGTGCATCCATAAAGAGCATGAATATGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGAGTCCCTTTGGCACGTGCTCAAGGACCTGTGGAGGGGGAATCAAGATCGCTGTCCGCGAATGTAACCGACCCGTGTAAGCTGCCGCTCTTTGTAGTCTTGCATCCTCACTGGACTGTGAATTGGCACCATGTTTCTCAATGTTCCCTGACAAATGGCAGCAGCAAAGCCATCCTGAAGAAGAACATTTTTCAAAAGAGACTGCATTTTAATGCAGTGGGTAGACTGGAGGCTTTGCTCTATTTTAATTGCAGTGAAACAGAAACAAGATCAAGAAAGCTGAAGAGATTTTCTAAGAAATATTTCCAGTGTAGATATAAGCTCTGAATGTGTTTTTTTCTACTGTAGGCCC[A/T]GAAATGGGGGGAAGTATTGTGTTGGACGCAGGATGAAATTTCGCTCCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGGAACAGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCAAATGTTCGCTGGGTGCCAAAGTACAGCGGAAGTAAGGGATTTAGTCCAGTGATTGCAACTGGAGTATAATAATCAGATTTAATGGACAGTTGTAAAAAATAATAAAATAATAATTGAGTTAATTACTTAATAAGTAATAATTTAGGCTATCACTTATTTAACGATCCTGTATCTTCCAAAAAATCATCAATGCGTTAAACTTAAACTTAAAAATATTAAATGAATATTAAAAATGCTGCCTTAGCAACCAAATCAAGGGCCCTATCATACACCCGGCGCAATAATGCACAAGACCTGTTTGCCCCGACGTTTTGCTATTTTCAAACCAGTGTAAGATTACTTTTCTTGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18108
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 640 1443 13 28
ENSDART00000138964 Nonsense 606 1405 12 27
Genomic Location (Zv9):
Chromosome 11 (position 19603775)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19021089
GRCz11 11 19183431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGRAA[C/T]AGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCA
Long Flanking Sequence:
TGCATCCATAAAGAGCATGAATATGTTCCAGTTGAGGGTGCCTGGGGCGTTTGGAGTCCCTTTGGCACGTGCTCAAGGACCTGTGGAGGGGGAATCAAGATCGCTGTCCGCGAATGTAACCGACCCGTGTAAGCTGCCGCTCTTTGTAGTCTTGCATCCTCACTGGACTGTGAATTGGCACCATGTTTCTCAATGTTCCCTGACAAATGGCAGCAGCAAAGCCATCCTGAAGAAGAACATTTTTCAAAAGAGACTGCATTTTAATGCAGTGGGTAGACTGGAGGCTTTGCTCTATTTTAATTGCAGTGAAACAGAAACAAGATCAAGAAAGCTGAAGAGATTTTCTAAGAAATATTTCCAGTGTAGATATAAGCTCTGAATGTGTTTTTTTCTACTGTAGGCCCAGAAATGGGGGGAAGTATTGTGTTGGACGCAGGATGAAATTTCGCTCCTGTAACTCTGAGCCATGCTCCAAGCAAAAGAAAGACTTCAGGGAGGAA[C/T]AGTGTGCCAGCTTTGATGGACGGCACTTCAACATCAATGGTCTACCTCCAAATGTTCGCTGGGTGCCAAAGTACAGCGGAAGTAAGGGATTTAGTCCAGTGATTGCAACTGGAGTATAATAATCAGATTTAATGGACAGTTGTAAAAAATAATAAAATAATAATTGAGTTAATTACTTAATAAGTAATAATTTAGGCTATCACTTATTTAACGATCCTGTATCTTCCAAAAAATCATCAATGCGTTAAACTTAAACTTAAAAATATTAAATGAATATTAAAAATGCTGCCTTAGCAACCAAATCAAGGGCCCTATCATACACCCGGCGCAATAATGCACAAGACCTGTTTGCCCCGACGTTTTGCTATTTTCAAACCAGTGTAAGATTACTTTTCTTGTTTTTTCACTACTTTCGTTAAATAGCAAATCCATTTGCGCCATTTTGTGGACTCATGAGTGTTCCGATCCAGAAAAGAGGTGTGTTAAGGCACATTGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41813
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109440 Nonsense 952 1443 20 28
ENSDART00000138964 Nonsense 918 1405 19 27
Genomic Location (Zv9):
Chromosome 11 (position 19613526)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19030840
GRCz11 11 19193182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGGCATGTGGTGTGGGCTACCGGTCTTTGGATATTTACTGCACCAAA[C/T]AGAGCAGATTGGATGGGAAAACCCAGAAGGTGGATGAGCGGTACTGCAGC
Long Flanking Sequence:
CCCTCTCAAATCTATCTTTTGAATTAATATTTTTGATAGGAAGCTATACAATATTATATTTGTGTACATTAGATTAGTCAGTACTGAAGCCAAATCTGGAGCTTTCTTACAAAATAACTTACAATAATGGTCCAAAACAACTACACCCAAATTTATATGTTATAGAAAATTATTAAATACAAATTTTAAAAAGAGGAAAAATCAAGAGAAGCAAAATAATATTTTGCTTGAATTTAATTAAAGATAGTCTTTCAATTTCTAAATATATGTTTGGTGATCATTAATACAATTTAATAAATATATCTTCTTAATAAATCTATTTTGTTTAAATCGACCGGAATACATTGCATATATTGATGGAGAAATTTTCATATCTCTGAACTAAAACCATCACTTATAAGTTTATTTCTGAAATTTTTAGGTGGCACATCGCTCGCAAAAGTGAGTGCACAGCGGCATGTGGTGTGGGCTACCGGTCTTTGGATATTTACTGCACCAAA[C/T]AGAGCAGATTGGATGGGAAAACCCAGAAGGTGGATGAGCGGTACTGCAGCAGCCAACATAAACCCAATGACAAGGAGGTCTGCCATGGAGACTGCAACCCTGGTGGATGGGAGTACTCCTCCTGGTCTGAGGTGCTCAAATCAGCCTATGTTAGACCTCGTTAATGTATATACATGACATAACTTACAATGAGCTATTTATCTTGGTTATCTAGTGTTCCAGGAGCTGTGGAGGAGGAACACGTCGCAGGAATGCAATATGTGGAAAGTCTGACGAAAGAGATGACGATAGCAAGTGCAACCCACAAGAAAAGCTCACAGCTCAGCCCTGTAATGAGTTCCTGTGTCCTCAGTGGAAAACTGGAGACTGGTCTGAGGTAAACATCTGATGGTGTATGTCTCGCAAAACTTATCATCAAATATAGATAATGTTGTCTAAGATTGTGCTTGCATGACTTAAACATCCTCGAAAAGATCTTAAAACTCTATCATGAATGCCAG
Associated Phenotype:
Not determined