Busch Lab

ZMP

si:dkeyp-38b6.1

Ensembl ID:
ENSDARG00000077722
ZFIN ID:
ZDB-GENE-070912-646
Description:
Novel protein similar to vertebrate protein phosphatase 2 (Formerly 2A), regulatory subunit B'', alp
Human Orthologue:
PPP2R3A
Human Description:
protein phosphatase 2, regulatory subunit B'', alpha [Source:HGNC Symbol;Acc:9307]
Mouse Orthologues:
CAAA01108492.1.1364.1, Ppp2r3a
Mouse Description:
protein phosphatase 2, regulatory subunit B'', alpha Gene [Source:MGI Symbol;Acc:MGI:2442104]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11938 Nonsense Available for shipment Available now
sa39836 Nonsense Mutation detected in F1 DNA Not yet available
sa14576 Nonsense Available for shipment Available now
sa19761 Essential Splice Site Available for shipment Available now
sa9325 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 None None 1141 None 15
ENSDART00000131977 None None 520 None 13
ENSDART00000139080 Nonsense 381 716 1 1
Genomic Location (Zv9):
Chromosome 2 (position 25394971)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25591167
GRCz11 2 25246801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTACAGGCAGTTTGAAACCTATTCAGAGTGTCCCTGGTTTGTCAGCA[C/T]GAACACCTCCATCAACTAATGGGTTCTCCCATGGCAGCTTGCCTACAGCC
Long Flanking Sequence:
AAAACCTAATAACCCGCATTCTGGAGAAGACCAAGGCAGACAGCAGTGCCTCAGGAGAAGACATAAAAGCCTGTCTTGACATTCTGCTCAAGTGCTCAGAAGATCTGAAGAAGTGCACAGACATCATCAAACAGTGCATCAAAAGAAAGTCAATGGGTGGAACTAGTGATGACTCAGGGAATCCTGAAATCATTTATAAAAATGTGATGGCCCGACTCTCCAACTACCTAAAGAGACTTCCTCTTGAGCTGGAACAGGGACAAAGTATAAGGCAGGAGCACAGTGAGCTTGCTGAACTAGTCAATAGTATACACGGACTACAACAAATCCCCTTCTCGCCTATCTTTGGCAATGAACAACCTCCACGATATGAGGACGTTGTTCAGTCTCCTCCACCTACGAAGCCTCGAAATAAACCCTCCCAGCCAGAACCTTCAGAGGGTTCTAGGGAACTTACAGGCAGTTTGAAACCTATTCAGAGTGTCCCTGGTTTGTCAGCA[C/T]GAACACCTCCATCAACTAATGGGTTCTCCCATGGCAGCTTGCCTACAGCCTCCAGTAGCAGTTCAACACCATTTATCTGCCAGCATACAGTTTCAACCAGCCGACCAGACACATTTTCTTCTGCAAATTCTTTCTTGTCTATCAGTAATGAAAACCTTTGTAAGGATCCAATGGAGGCTCTGTACATTGAGGAAGAAGATTCAGATATAGGAAGGATGCCGGACAGGCCAGTTAAAGGGGATGGGAAGCACAGCTGTAATCTTTCGGAGTCCAGACAATACTCCAAAAGAACTACTGGCTACTCAGAGCCTAGTGGTGGTGTTTCGGATAAACTACATGAGCTTAGCAGAAACGGAACCACATTCAAGCCGCAAAATGACTCTACTGTCAACCAGATGTACCTGCCAAAAAGCACAGATTCTAAACTGTTCTCAAGGTCCACCTCACACACGAGTAAAGGGGGAGCCGATGATATTGATAAACTCCTGATGGACCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 452 1141 2 15
ENSDART00000131977 None None 520 None 13
ENSDART00000139080 Nonsense 472 716 1 1
Genomic Location (Zv9):
Chromosome 2 (position 25395244)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25591440
GRCz11 2 25247074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGCCAGTTAAAGGGGATGGGAAGCACAGCTGTAATCTTTCGGAGTCC[A/T]GACAATACTCCAAAAGAACTACTGGCTACTCAGAGCCTAGTGGTGGTGTT
Long Flanking Sequence:
AGGAGCACAGTGAGCTTGCTGAACTAGTCAATAGTATACACGGACTACAACAAATCCCCTTCTCGCCTATCTTTGGCAATGAACAACCTCCACGATATGAGGACGTTGTTCAGTCTCCTCCACCTACGAAGCCTCGAAATAAACCCTCCCAGCCAGAACCTTCAGAGGGTTCTAGGGAACTTACAGGCAGTTTGAAACCTATTCAGAGTGTCCCTGGTTTGTCAGCACGAACACCTCCATCAACTAATGGGTTCTCCCATGGCAGCTTGCCTACAGCCTCCAGTAGCAGTTCAACACCATTTATCTGCCAGCATACAGTTTCAACCAGCCGACCAGACACATTTTCTTCTGCAAATTCTTTCTTGTCTATCAGTAATGAAAACCTTTGTAAGGATCCAATGGAGGCTCTGTACATTGAGGAAGAAGATTCAGATATAGGAAGGATGCCGGACAGGCCAGTTAAAGGGGATGGGAAGCACAGCTGTAATCTTTCGGAGTCC[A/T]GACAATACTCCAAAAGAACTACTGGCTACTCAGAGCCTAGTGGTGGTGTTTCGGATAAACTACATGAGCTTAGCAGAAACGGAACCACATTCAAGCCGCAAAATGACTCTACTGTCAACCAGATGTACCTGCCAAAAAGCACAGATTCTAAACTGTTCTCAAGGTCCACCTCACACACGAGTAAAGGGGGAGCCGATGATATTGATAAACTCCTGATGGACCTGGAGTGTCTTTCCCAGAACATGCAAAAGGAACCTCCATTGCCTCCTAAGCTTAAAAATTGTGCCCTACAGACAAGTTCCCCCCAGCATTTGATTGGTAACTCTGTGGTTAAGGATCTACCTGTTGTAGGTTTCTCTGGACCCTCGGTGGCCAAGCCACCAGAGCCAGGGGTTGAGTCTACTGAAGAGGATGATGGAGCTCTTCTGCTCAGGATTCTGGAGAGCATTGAAAGCTTTGCTCAGGAGCTGGTGGAGAGTGGAGCCGGGAGAGGAACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 727 1141 4 15
ENSDART00000131977 Nonsense 104 520 2 13
ENSDART00000139080 None None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25428557)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25624753
GRCz11 2 25280387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCCACGCTTCTACTTCCCCAAAGGCCTTCMAAACTGTGCAGCCAACTA[C/A]GACGAGGCCATTGCCAAAATCGAAGCGGCYTTCACTGAGTTCGAAGAGGA
Long Flanking Sequence:
TTTTTGCAAAGTTCAACAGGGTATACTGTATATGACCAAAAGGAAATTAAAGCTAGCATTTAATTAGCTTTGTTTGTGTGGTAAGAACACCTAAACATCTTATTGCTGGGTGATTTGCAGTACCTTTTTCCACATCCTCCATTTGCTTCAGACACATCCTCAGCTGAACTATTTAAGATATGTTTTGGAAAGTCACTTCTATTTTCCTCTTCTCTTCAGCTCAATGTTTTTAAAGCCTTGTAAAAAAAACTTAAGGCCTAAAAGTTGTTGCACGTATTGATATCCTGTTTCTTTCTATCGTCTCTTTTTGTATTTCAATAGATCCAACCTGAAAAGAAACCTGGAACTCCTCCTCCAACACTATCACCTGCACCGTCCTCGCCGACCCCACGGCCACCCAGCCCTCCTCCAGCCAAAGTAGTGGCCACACCACCACCCTCCTCCATAAACATTCCACGCTTCTACTTCCCCAAAGGCCTTCCAAACTGTGCAGCCAACTA[C/A]GACGAGGCCATTGCCAAAATCGAAGCGGCCTTCACTGAGTTCGAAGAGGAGAAAGCTGACATTTATGAAATGGGAAAGATAGCAAAGGTGCATGCAAATTGGGAATTGTTTTGCTTAAAATGAGATTTAGAATATTGGAGATTCTCTCCGTAGTCTTGGATTGATGGCAATAAACATGCAAGCTGACACTTGTTTTGCAAAGTCCTCGCTTGGAGATTTGCATTGCCGATTTGTATTGGCATGGCACAATGATGGATGCCAGCTCATAACATTGTGCTTTATTTGCACTGATTTTGAATAATATATAAACGATGGAATATAAAAAGGAAGCATCAACAGAATAACTCATCCTGACATTTACACTCATTTATATTTGGATTTTGAATATCATATCATTTAGATTTTAGTAATAGAATGCAAATGTGATATCAGCTGCGTTATTTTATTTCTGTGAAAAAAAATAAGATTGTGTATGTGGCTTTATATACCAGGGCTATTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3423
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 899 1141 9 15
ENSDART00000131977 Nonsense 276 520 7 13
ENSDART00000139080 None None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25434797)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25630993
GRCz11 2 25286627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCTGGAAGAAGAGGACGACATCAATCAGATCACAGATTATTTCTCTTA[T/A]GAGCACTTCTATGTTATTTACTGTAAGTTCTGGGAGCTTGACAGTGACCA
Long Flanking Sequence:
ATCTTGTTTAATCATCCAGGCTTCATGCAATTGTGCACCATGGTCAATATGGTGTAGAATGTGCAGAGAACTTTAAAGACTTTTCAGGTTTACATCCAAAGTAGTCAGTTCTGATTATCGATTGCTCTAAGATGAAGTGTTTCCAAACACATTGCAATTCCATTTCATGTCAGTGTTTTAGAGATGAAGTGAGCACTTGAGTCTAGCTTAAGTTTTGATAAAACATCCTCTCTCTGTCTTCCAGGTGATTCAGAGAATATTTTACACAGTCAATCGCTCCTGGACAGGCAAGATCAACATGACAGAGCTCAGGAGAAGCAACTTCCTCCAGGTAAACACTGTTAAATGCCATCATAACTCTAGGCTCTTCAGTGCATTCTGTTCAATTTCCGAAACTTGAAGGGACTGTTTAATCAGAAGCCACTCTTACCATCTCACCAGACGCTCGCCTTGCTGGAAGAAGAGGACGACATCAATCAGATCACAGATTATTTCTCTTA[T/A]GAGCACTTCTATGTTATTTACTGTAAGTTCTGGGAGCTTGACAGTGACCATGACCTCTTCATTGACCCCAAGGACCTGGCCAGGTACAATGACCATGGTAAGTACACAGTAAATCCATTCGAAACAAGTCTCATTTATTAAACTTTATCATTGTTTTAGCGAATATTCACACAATAGTTAAGTTTGTTGGTAAACTATGCCTTTCATTAGCCTACTTTTGATGTGTGTCTGCTCTGTTCTTCTTTGCAAAGCTTCATCAAGCAGAATCATTGAGAGGCTGTTTTCAGGAGCTGTCACAAGGTAGGAGCTGCTGTGGAGAACAAAGGTCATTTCTGAGATTTTGACTTTTGAGTGTTTTATAAGTGGCTTAAGACCTGTTTTTTTTTTTTTCTTCTAAGGGGAAACTCAGTGCAGAGAGAGGGGAGAATGAGCTATGCAGAGTTTGTTTGGTTCCTCATTTCAGAGGAGGACAAAAAGAACCCCACAAGGTAAAAAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19761
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Essential Splice Site 978 1141 11 15
ENSDART00000131977 Essential Splice Site 355 520 9 13
ENSDART00000139080 None None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25435286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25631482
GRCz11 2 25287116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTTGTTTGGTTCCTCATTTCAGAGGAGGACAAAAAGAACCCCACAAG[G/A]TAAAAAGGCAGATGCAAATGCTGCTGTCACCAAGTTTTACTTTAGATCAG
Long Flanking Sequence:
TATTTCTCTTATGAGCACTTCTATGTTATTTACTGTAAGTTCTGGGAGCTTGACAGTGACCATGACCTCTTCATTGACCCCAAGGACCTGGCCAGGTACAATGACCATGGTAAGTACACAGTAAATCCATTCGAAACAAGTCTCATTTATTAAACTTTATCATTGTTTTAGCGAATATTCACACAATAGTTAAGTTTGTTGGTAAACTATGCCTTTCATTAGCCTACTTTTGATGTGTGTCTGCTCTGTTCTTCTTTGCAAAGCTTCATCAAGCAGAATCATTGAGAGGCTGTTTTCAGGAGCTGTCACAAGGTAGGAGCTGCTGTGGAGAACAAAGGTCATTTCTGAGATTTTGACTTTTGAGTGTTTTATAAGTGGCTTAAGACCTGTTTTTTTTTTTTTCTTCTAAGGGGAAACTCAGTGCAGAGAGAGGGGAGAATGAGCTATGCAGAGTTTGTTTGGTTCCTCATTTCAGAGGAGGACAAAAAGAACCCCACAAG[G/A]TAAAAAGGCAGATGCAAATGCTGCTGTCACCAAGTTTTACTTTAGATCAGCTTTGAGAACCTATGCTGTTACAGGTTAAGGTAATTAACATAAATCCCAAAATAAAAAAACTCATTGTTTAAACTGTTATTTTAGCTTATTTTATCTTTGAGTGGTATTGACGGTGGTATAGAATTTTCATTTTAAAGTTGTGTTTTTGTTAATGTATTAAGTTTTTATATGTATGTAGCATTAATTCATGTTTACCTTAATATTTATTTTTTTGTTTAGGTATTTGAGTTTTAAGTCACTACATTAAGAAAAATTACAAAAAGGTTTTGCTATCTTAAAATTAATAATTGCTTTGGAAACAATCAAATAAATAAGATTCAAAATTAGAATAAAATGTAATTAAAAATAAATCTTGATAGGTTTCTTTTTCAAACAAATAAAAATGAAAAAAAGCTCACAAACATGCTGAAACCATGAAAATAAAGTAATAAAAAAAAATTAAGTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110922 Nonsense 1084 1141 14 15
ENSDART00000131977 Nonsense 461 520 12 13
ENSDART00000139080 None None 716 None 1
Genomic Location (Zv9):
Chromosome 2 (position 25437683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25633879
GRCz11 2 25289513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAATTGTAAGTGTGTGTGTGCGAATCAGGATTTGGATAGTGACGGTCCA[G/T]AGCCCTCAGACTGGGACAAGTATGCCTCTGAAGAGTATGAGATTCTTGTG
Long Flanking Sequence:
GAGGACACTGATATAGCATAATATCATTATAGTCATCATTTTTGGTGTGAATAAGCCTTTATTTCTTTTCATATCAGTTAAATGCTCACAAGAGAAAAAATGTGTAGGTACTACACATTTACTGAAATGTTTTGAATAAAAATGTGACATGCTGATAAATTGTTTACTTTGAATACTCTGAAATCTGCTTTGACTAAAAAGTAAATGAACGCATATGCAATTGTAAAGAACCGGTGACATATCTTGGCAGGTAAAATTACTCTTCGAGATCTGAAGCGCTGCAGGATGGCACACATTTTCTACGACACATTCTTCAATCTGGAGAAGTACCTGGACCATGAGCAAAGAGATCCCTTTGCAGTGCAGAAGGTACGAGTTTCCTGGGTTGCATCTATATCTAGATCCACTGTGCTGAATGTCATCTATGTTTGCACTCTGTGAGTGTGTTCAGTAATTGTAAGTGTGTGTGTGCGAATCAGGATTTGGATAGTGACGGTCCA[G/T]AGCCCTCAGACTGGGACAAGTATGCCTCTGAAGAGTATGAGATTCTTGTGGCAGAGGAGACAGCCAACGAACAGCTACGCGAGGGGTGAGTCAATGCGCTCTGTAATGGAATGAATTTGCTACAGACTTCACAACATTGCACAGCGCTGAGATACGGTCTATATGTGGCTGAATTTCATACGGTGGGAAGCGTAACTGTTGCGTGCTTGCTTTTGCAGGTCTTTCGATGACGATTACGAGTCCGATGAGCTCACAGTCTCCTCAGACATTGGAAATAAAATGGATAAGCTGGTCATATCTGATTTATCGGCATAATCTGCCGTTTTTTTGTCTACACACAGTGATGTTGAATGGAGAACCACCACGCCATATTTTCCCCTCACGTGTCAAAAAGGGAAAAAAGGAGAAAGTTTTTCTACGTTTCATTAAGGACAATTGTGTGTGTGTGCATGTGTGCAATAGAACTAATTCTAAAACCAAAAGGTTTCAGACACCCACAA
Associated Phenotype:
Not determined