Busch Lab

ZMP

si:ch211-218o21.3

Ensembl ID:
ENSDARG00000077709
ZFIN ID:
ZDB-GENE-081105-73
Description:
Novel protein similar to vertebrate IQ motif and Sec7 domain 1 (IQSEC1) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
IQSEC2
Human Description:
IQ motif and Sec7 domain 2 [Source:HGNC Symbol;Acc:29059]
Mouse Orthologue:
Iqsec2
Mouse Description:
IQ motif and Sec7 domain 2 Gene [Source:MGI Symbol;Acc:MGI:3528396]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa34453 Nonsense Mutation detected in F1 DNA Not yet available
sa14795 Essential Splice Site Available for shipment Available now
sa7145 Nonsense Mutation detected in F1 DNA Not yet available
sa15370 Essential Splice Site Available for shipment Available now
sa38703 Nonsense Mutation detected in F1 DNA Not yet available
sa15249 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34453
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 56 1276 1 12
ENSDART00000140410 Nonsense 153 1373 2 13
Genomic Location (Zv9):
Chromosome 8 (position 38060943)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36916358
GRCz11 8 36948792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGAGAGCCGCATGACACGCCGCATCATCCTCTCCAACATGCGACTG[C/T]AGTATTCATTTGATGACCGGCATCCTCAACCACCCAACCCGACTCACTAC
Long Flanking Sequence:
TTCAGAGAGTTCCAGCAAATCTCCTTACGTGCACAGTTCTGACCGCTACGGGGACAACAGCTGTGGCCCGCCAGGCCCTCGGGTGCCTTTTGTGCCCCCTCCGAGCCCAGCTAGCCTTGCCTGGGCACAACGTACACGCAACCAACCAGCTAGTCTGGCCCTTCGCAAGCAAGAGGAAGAAGAGAACAAGAGGTGCAAAGCCCTATCGGACAGCTATGAACTCTCTACGGACCTGCAAGATAAGAAGGTAAGGCATACAAAAAAAATTAATCAAGATTCGCAGCAAATCACATTCCCTTAAATTAAATATAACCACTGTCATTGTGCAGGTGGAGATGCTGGAGAAGAAATATGGCGGCTACTTCGTGAGCAGACGAGCAGCACGTACTATCCAGACAGCATTCCGTCAATATCGTATGAACAAGAACTTTGAGCGCTTGCGCAGCTCAGCATCTGAGAGCCGCATGACACGCCGCATCATCCTCTCCAACATGCGACTG[C/T]AGTATTCATTTGATGACCGGCATCCTCAACCACCCAACCCGACTCACTACAGTCACAGTCCAGGAATGGGTCCTCCGCATTCTCCAACCAGCACCACAGAGCCAAGCTCTCCACGGCCAGAGTACACCCAACTGGAGGACACTTTCTCCAAACAAGTTAGTACTCAGTTGACTCTATCATAGCATGTGCTGGATGCCTTCCTTTAATACTCTAGGTAAATAAAGAAGCCAGAATCCTCTCTTCACTTTATTTCTTAGTTAAAGCTTTGTTTAGGGCCATCTATTGTTATGTCGTTCAAAAAATAATTGGATTCATACCTTACCACAATGTATCTTGATGGGTTCTGCGAATGAAGCCAATGTTGACTTCAGGAAAAGAATGAATAAAAATACACTTTTAATAATAAATTTATTCCAGTAAAAAAGAAGAATTAAACAAATACAAGAACAAAACTAAATTCTTTACTTTATCTCTCACTGAAAATAAAGGACCTAAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14795
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Essential Splice Site 107 1276 1 12
ENSDART00000140410 Essential Splice Site 204 1373 2 13
Genomic Location (Zv9):
Chromosome 8 (position 38061099)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36916514
GRCz11 8 36948948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTCCACGGCCAGAGTACACCCAACTGGAGGACACTTTCTCCAAACAA[G/A]TTAGTACTCAGTTGACTCTATCATAGCATGTGCTGGATKCCTTCCTTTAA
Long Flanking Sequence:
GGCCCTTCGCAAGCAAGAGGAAGAAGAGAACAAGAGGTGCAAAGCCCTATCGGACAGCTATGAACTCTCTACGGACCTGCAAGATAAGAAGGTAAGGCATACAAAAAAAATTAATCAAGATTCGCAGCAAATCACATTCCCTTAAATTAAATATAACCACTGTCATTGTGCAGGTGGAGATGCTGGAGAAGAAATATGGCGGCTACTTCGTGAGCAGACGAGCAGCACGTACTATCCAGACAGCATTCCGTCAATATCGTATGAACAAGAACTTTGAGCGCTTGCGCAGCTCAGCATCTGAGAGCCGCATGACACGCCGCATCATCCTCTCCAACATGCGACTGCAGTATTCATTTGATGACCGGCATCCTCAACCACCCAACCCGACTCACTACAGTCACAGTCCAGGAATGGGTCCTCCGCATTCTCCAACCAGCACCACAGAGCCAAGCTCTCCACGGCCAGAGTACACCCAACTGGAGGACACTTTCTCCAAACAA[G/A]TTAGTACTCAGTTGACTCTATCATAGCATGTGCTGGATGCCTTCCTTTAATACTCTAGGTAAATAAAGAAGCCAGAATCCTCTCTTCACTTTATTTCTTAGTTAAAGCTTTGTTTAGGGCCATCTATTGTTATGTCGTTCAAAAAATAATTGGATTCATACCTTACCACAATGTATCTTGATGGGTTCTGCGAATGAAGCCAATGTTGACTTCAGGAAAAGAATGAATAAAAATACACTTTTAATAATAAATTTATTCCAGTAAAAAAGAAGAATTAAACAAATACAAGAACAAAACTAAATTCTTTACTTTATCTCTCACTGAAAATAAAGGACCTAAGACTGACAGTATACAGAAGTCTGTTTAAGCGTGCTCCTGGTTTGTACTTTTATACTGTATTCAAGCCTTTGAATACAAAAGTGCCCCTAATGTTTTAAGCTATCAATGTTTGATATACTTGAGTATATCTTCAAAAATGTTAATACAAAGAAGAAAATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7145
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 378 1276 2 12
ENSDART00000140410 Nonsense 475 1373 3 13
Genomic Location (Zv9):
Chromosome 8 (position 38064245)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36919660
GRCz11 8 36952094
KASP Assay ID:
554-5280.1 (used for ordering genotyping assays)
KASP Sequence:
CACCRCTCTCATCTTCCTCRTCTGCACCACTGCCCCCTGGTGGCTTGGAG[C/T]AACAGTGCTGCTCAGATGGGGATAATGACTCTCTGAACTCCACCACAAAC
Long Flanking Sequence:
GGGGGGGTGTTGGAAGTGGAGTCGGTGGCAGGGAAGACAGTCGGGACACAGAGGGCGGAGGAAGTAGCAATAGTCGCCGAAGCACACCTTGCACAGAGTGCCGTGATTACCGTTTACGGGGAGGGCATCTACCACTACTTACAATTGAACCACCAAGTGACAGCTCAGTGGACATGAGTGACCGCTCAGACCGAGGCTCCCTTAGCAGACAACTAGTGTATGAGCAGGACTCAGCAGGAGGGTCGCCTCAAGGGACTTTAAAACATAACCCTAATGCTCGTTCACAGTCCTCCACAACTGCACAGGGTCAAACCCGTCCAGCTAGCCGATCGATACCGTCGCATATCCCTCACCACATGGCGCACCACCATCACCATCACCACCACCACCATCATCACCAGTACCCAGACACCCCTTCGTCATCGTCCTCCCCTCAACAGCCCCCTACCACACCGCTCTCATCTTCCTCGTCTGCACCACTGCCCCCTGGTGGCTTGGAG[C/T]AACAGTGCTGCTCAGATGGGGATAATGACTCTCTGAACTCCACCACAAACTCTAATGAGACCATTAATTGCAGCTCAGGATCCTCATCAAGGGACAGTCTGCGGGAGCCCCTACCTCCATTGGGGAAACAGACGTATCAGAGAGAAAGCCGGCATAACTGGGACTCTCCTGCCTTTAATAATGATGTGGTTCAGAGAAGGCAATATCGCATTGGGCTCAATCTCTTCAACAAGTAAGAGAAAATGAAAACCTATCTTCTACCACTTTACCTGAAAGGGGTGTTTATAAGACTCAGGAAATATTCATAATCACATGGCACATGTCATGAATATGAAGGAGATTTTATGCATGCTGTATTATTAACCCTAATCATTAGCCCCTTTCACACATACAGACCTTTCCGGAAAATTGCCGGTCATTTGTGAACAGGCCCTTTATGAAAATACTGGTAAATTCATTCCGGCAATTTTCCAGAAAGAGAAATCGTCACATTACTGGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3663
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 538 1276 4 12
ENSDART00000140410 Nonsense 635 1373 5 13
Genomic Location (Zv9):
Chromosome 8 (position 38067850)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36923265
GRCz11 8 36955699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WCCTCGATGATGCTTTGAGGAAATTTCAAGCTCAGATAAAAGTCCAAGGA[G/T]AGGCCCAAAAAGTGGAGAGACTTATTGAGGCTTTCAGGTAGCTAAATGTG
Long Flanking Sequence:
TGTAAAAAAACAAACAAACGTAATAACACATCAGGTTTGTAACAAGATGTAAGACATGGGAATATTTAACCATTTACTGCATTTTAAATAATGACTAATTATACATAATAAATGATGAATATTAATTATATTTTGTCATGTGTGTCAATTCATATACAATATAAACCCTACATGTTTTATTAGTGATAAGTATTGAATAACTATACAGGCTACATGATGCTAAAAATACTAAATTGTTACAATTACATTCATATTAATTAATACACAACACATTTATTTAAAGAAATAATTTCTCCTAAAGTGAAATAAAGCCCTGAAGTAAAACCCTTTAATAGTTGTCGTAAAATACACTCTAGGAGCATGTTTAACAGGAGCATCTATTGTATGTTTATGTAACATTATCGTCTGCTTTTAGCTGTGTTGTTGACGAAATGGACTTTTCTGGAATGGACCTCGATGATGCTTTGAGGAAATTTCAAGCTCAGATAAAAGTCCAAGGA[G/T]AGGCCCAAAAAGTGGAGAGACTTATTGAGGCTTTCAGGTAGCTAAATGTGCTCTCAGTAAATAATATACTTAGCACTTTAAAATAATCACATTGAACAATGATATCTGTTGGTTACAATGAATATAACAGCATTCATGGGATAGTTCACCCAAAAATGAGTTTATTTATGGGTTTCTTTATTCTGTTGAACACAAAAGACAAAATTTATTTAAAAAAAAAGCTATGAACCTGTAATCATTAAAATAAACAGTCAATGGTTACAGGTTTTCACCGTTCTTAAAAACATCTTTTTAGTATGTTCAATAGAAGAAAGAAAGTCCAACAAATGAAGGGACAGTAAATTCTGACTTCATTTTTAGTTCTAGGTGAACTATACCTTTAAAGAATCATGTTTTATCATGTTTACCATGTTTTATCTGCCCCTCAAATATTTGCTCTCAAATATTACTTCTCTATTTCACAGTCAGAGGTATTGCGTTTGTAATCCAGCACTGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Essential Splice Site 550 1276 5 12
ENSDART00000140410 Essential Splice Site 647 1373 6 13
Genomic Location (Zv9):
Chromosome 8 (position 38068313)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36923728
GRCz11 8 36956162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTATCTGCCCCTCAAATATTTGCTCTCAAATATTAYTTCTCTATTTCAC[A/C]GTCAGAGGTATTGCRTTTRTAATCCAGCACTGGTAAGACAGTTCCAGAAC
Long Flanking Sequence:
TTTGAGGAAATTTCAAGCTCAGATAAAAGTCCAAGGAGAGGCCCAAAAAGTGGAGAGACTTATTGAGGCTTTCAGGTAGCTAAATGTGCTCTCAGTAAATAATATACTTAGCACTTTAAAATAATCACATTGAACAATGATATCTGTTGGTTACAATGAATATAACAGCATTCATGGGATAGTTCACCCAAAAATGAGTTTATTTATGGGTTTCTTTATTCTGTTGAACACAAAAGACAAAATTTATTTAAAAAAAAAGCTATGAACCTGTAATCATTAAAATAAACAGTCAATGGTTACAGGTTTTCACCGTTCTTAAAAACATCTTTTTAGTATGTTCAATAGAAGAAAGAAAGTCCAACAAATGAAGGGACAGTAAATTCTGACTTCATTTTTAGTTCTAGGTGAACTATACCTTTAAAGAATCATGTTTTATCATGTTTACCATGTTTTATCTGCCCCTCAAATATTTGCTCTCAAATATTACTTCTCTATTTCAC[A/C]GTCAGAGGTATTGCGTTTGTAATCCAGCACTGGTAAGACAGTTCCAGAACCCAGACACCATCTTCATCCTAGCGTTTGCCATCATCCTGCTCAACACAGATATGTATAGCCCCAATATCAAAGCGGAGAGGAAGATGAAGCTGGACGACTTCATCAAAAACTTGCGAGGTGCTGTTCAAATCCCTCTCTCTTAAGCGTCACACATTCACACACTAGATCTTACTCGAGGGGTCAACCCGCAATCTGCTTTTAAATGTGTCATCTAGCTGTGAGGGATTTCACAAGCGTATGCTAAATCTCTTCTTGTGTGTCTGTCAATTTTTTCTTCCTTTCTCAGGGGTGGATAACGGTCAGGAGATCCCACGTGACTTACTAGTCGGAATCTACCAGCGCATTCAGAAGTGGGAACTGAGAACCAATGATGACCATGTTTCTCAGGTCCAGGCAGTAGAGAGAGTCATAGTGGGCAAGAAACCAGTGAGTACTACCGAGTGGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38703
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 660 1276 7 12
ENSDART00000140410 Nonsense 757 1373 8 13
Genomic Location (Zv9):
Chromosome 8 (position 38071821)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36927236
GRCz11 8 36959670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAAATACCTTTTCTTTGATTAAAGGTTTTGTCTCTGCCTCACCGG[A/T]GACTGGTGTGCTGCTGTCAGCTCCATGAAGTCCCGGACCCTAATCGTCCT
Long Flanking Sequence:
ACCGGTTAGCATTTAGGCAGATCACTGCACCTTTAATGAAGACCGCAATAATAATAGACACCAATGAACGCATTTATGAAGGGATTAAGTGTTCTACAAACAAGTTTAAATGGGTACAAATACTTTACAATAAATCAAAACCTCTAGTGTTAAATTAATGTTAGTGATTAAATAACTCTTAATCAGAAAAATCACAGACACTGTACAAGGACTGTGCTTGTATGCTAATGTACACATAAAAAGTCAACTTTGGGCTGATCTTTCAGACTATTGTGTGGACTGTATGGATTTGGTTTGGGTTAGTTGAATAAATTAATAATAAATACATTTCAGAAGATATCGAGTAGACATTCTACAAACTCTCTGCAAGTTTGTGACTTAAATGTACTTGTCAACAGAATTCATAAGGAGGATCATCACATGATTTGATAACGATTAGTAATGTGAAAGTGAAGTAAATACCTTTTCTTTGATTAAAGGTTTTGTCTCTGCCTCACCGG[A/T]GACTGGTGTGCTGCTGTCAGCTCCATGAAGTCCCGGACCCTAATCGTCCTCAGAGGTCTGGAGTCCACCAGAGAGAGGTCTTCCTCTTCAACGATCTGCTTGTGGTAATATTAATAATCCATTATTCATATAACAAAAGATTTGGTCTTACACTTTAGCAAATAATCTGCATAATTGTGTCTAGTAAAGTCACTACATATTAAATAGCTTCTTTTTCTTTATTACATTACAAGGTTACAAAGATTTTCCAGAAGAAGAAAACTTCAGTAACTTACAGTTTCAGGCAGTCCTTCCCTTTGGTGGAGATGCAGGTTCACATGTTCCAGAACTCCTGTAAGATTTTAAACTGGTTACTTATTGTTTTTCTTACATATTCTACATATACATCTACATGTGTTTATACAATACCTCAATAGTTTGTGTCAGAAGTTTTCCTGACACAGAATAGATGTATTTGATTGTATTTATTTGCTCCAAAAAATAATTCAGTATTATTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 833 1276 10 12
ENSDART00000140410 Nonsense 930 1373 11 13
Genomic Location (Zv9):
Chromosome 8 (position 38076359)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36931774
GRCz11 8 36964208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATGGGAAGGCCTAGTCTGGATGACARCTATTCACCRGGAGAAGGCCTT[A/T]AACGTACTGCTCTCAGCTCCTCACTGAGGGACCTGTCTGAATCAGGTGAG
Long Flanking Sequence:
ATGCACATGCTGGAATTTAATGGGTAAATGTGTTTGTGTCATAGTTTACCACATTTTTCTTGGGAAAAAAAAAGTTTATCCTACTATCCCAAACTCTCAAATTGATCTGCATATGGCATTTGCGTTAAGAAATTTTTTAATGCAGTAATCCAAAATGCTCATAAAAATAGGTGAATGAAAAGCTACTGAATTTTCAGTTTTGAGTGAACTATTCTTTTCAAACTAGATAAAAAAGCACATTCCAAACACCTTGCTTTAATTAGTTCAAGCAAATCATGCTTGGTAAAGATAAAAGGTGTTAGTTCATAAACCGTCCTCTCATGTTTCTTGCGATTTATCCTCCTGCAGCTGAGCTAGAGAAGCAGAAGGGAGTAATGCGGCCCAGCCTGCTCACCAACAGTATTATGGCAGGAGGAGTGGGCGGGGTCAAGAATGAAGTAGTGAATGGCACTATGGGAAGGCCTAGTCTGGATGACAACTATTCACCAGGAGAAGGCCTT[A/T]AACGTACTGCTCTCAGCTCCTCACTGAGGGACCTGTCTGAATCAGGTGAGACACTATGCTATGCCAAATGAGGGGCAAATATAAAATGTTAAATTAACAGTTTATACCAGTGGTCACTAAATTTGTTCCTGGAGAGCCTTTGTCCGAGTTTAGTTACAACCCTAATCAAACACACCTGAACAAGCTAATCAAGGTACCTGGTAAAGCCGTGGTCATGCTGCACTTTTCTCCAATAGACTTTCATTCATACTCGCACAAATACGGCAGACTGGAAACGCAAGCTCATGCGACAAGTTTCGCAGTTCGCTGCGTTGCAAAGTTCAAGCTTGGTGAATTCTGACCTAAAAAATTACATCATATGACTGTGTGAGACCAATCAAAGGTCAAAACATGACTTTTTTGTGCAGGAATAATAAATATGGACCGATCTCTTACTTTTTTAACATCTAATCATCTTGTTTAATCCCACCCTTTTTTGCAGCGTCAAACGATAGAATTTT
Associated Phenotype:
Not determined