Busch Lab

ZMP

A5PF17_DANRE

Ensembl ID:
ENSDARG00000077696
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PF17]
Human Orthologue:
FAM188B
Human Description:
family with sequence similarity 188, member B [Source:HGNC Symbol;Acc:21916]
Mouse Orthologue:
Fam188b
Mouse Description:
family with sequence similarity 188, member B Gene [Source:MGI Symbol;Acc:MGI:3583959]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27164 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21251 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27165
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114194 Nonsense 333 752 6 19
Genomic Location (Zv9):
Chromosome 8 (position 19032354)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18477242
GRCz11 8 18512954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATTCTAGGGGCCCACAGAAACCCACAACCATTTCTGTATTCCATATTT[A/T]AAAGAGGGCCCAGGATTTGCAGGCATTGCTTTGAATATATAAATGAATTT
Long Flanking Sequence:
TTCCATATAAATAAAGTCATTAAATACAATTCTGCAGCTCCTGGTCAACCATAATTCAGACTCAACATTGCAGATCTTGCGATGTGACTATTGCAGATGCATACATTGCTATATCGATGCTCAAACGTTACATTGAATCATTCATTCATTCATTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCCACAGCGGAATGAACAGCCACAGCTCAACTTGTATAATATAATTAGCTTCTAAGGTACCGTAAATGTAGCGATTTAATAATGTTTAAATATTTATTCAGGTAAAAAAAAATACAGATTTAAATAGTGAGTAAAAAAATATTTATAATGTCTAAATATGTTACACAGACCTATTCTGCTGTTTGTCGAAATGTCGTTGTATACTAGTTCAATCAATTGTCGAAATGTATCAAAGATCATATCTAGTGCGCTGAGAATAATTCTAGGGGCCCACAGAAACCCACAACCATTTCTGTATTCCATATTT[A/T]AAAGAGGGCCCAGGATTTGCAGGCATTGCTTTGAATATATAAATGAATTTTATATGTATCAGATCTCTTATATATAAAACAATATGGCTCTAAGATGCTGCAGTTTTGTATTTCAAAAAAAGGCTGTTTGTATTCATGCTCAACTGCGATAAGCCTGTGTGATTATTAACTTTTATTGTTTCCTTTATATTGTTTCTTCTCCAGAAAGAATTCGGCGCCCAGCCTAAATTTGGATGGCCTCCATGTGCTGGAAATGGTTTTAGGTAGAGCACCTAAAATCTCCAGCAGATTGCATTTTGTATCATAGCCAATTTCAACTACAGATTACTGTTGTGTTGCTTTAATATAACTGAAGTGCAGTTTTGTATTTCACTTTCAATATTTCATCTTGTAACATTACAGATTTGCTGCTGACCTATGCCTAAAATAGCCTATTGTTTAAAATCAAACTCTTCTGAAATGCTTCATATCTTTACAGATGACATTGAGTATGAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114194 Essential Splice Site 652 752 16 19
Genomic Location (Zv9):
Chromosome 8 (position 19026411)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18471299
GRCz11 8 18507011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAG[G/A]TAATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTC
Long Flanking Sequence:
GCTGCCATCATTAAAAAAGCCTTTTAAATAAAGTATTAAATACATTGCAGTAGTTCAGTGCTTGTGTCATTTCACTGTTAATATGCATAAATCATTTATCAGATTTTTTTGTTTTGTTTTATTTTTATGTTTGTATTGTTTGAGTTTTTACAAAATCTGATTCAATTCCATGTTAAAAACTCCTTTAGGAATACTATCCCTAGGAAAAAAATGTTCATGTTACGTATTTTCTCTCGCTGTAGTTAAGCTGGTTGCGTTTTTGCATATCTTCTGTGTGTACAGTTTTCTGAAATGATTAAGTCATTAAATCTTACAATTTCCTTTTCATTTTTCTTAAGGAATTGGTAAATCTATTACTTTGTGGACGCGCTGTTTCAAACGTCTTTGATGATGAAATGAAGCTTGATTCCGGAAATGGAAATTTTACCCTTCTGAGGGGAATTAAAACACGATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAG[G/A]TAATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTCATCTTTTTTTGCTTTTCTTTTTCTAAAGGTTGGATCTCACCTGAAAAACCCCACGTTTCCAATTTGGGTGGTGTGCAGCGAGAGCCATTTCAGTGTTCTCTTTAGTCTCTCTAAAGATCTGGCGTCCGATCACTGTACGGAGAACGAGTTTGACTTGTACTATTATGATGGATTGGCCAACCAGCAGGAACCAATTAGATTAACAGTCTGTGAGTGTTTTCCTTTGCTTCAATGTTTTTCTGGACATAAGTGCACATACGAAACAAAACACCCGATTGTGGTGTTTCCGAAAACTAAATAAACTCAACCTTTGCACACCTGCTCCATAATTAGGGTTTATAATAAGTCTGTATTTAAAGAGAATCGTGTGTGTCTGAACAGATCCACATTCTGCTGCTAAGGCTGCTGCGCACAATGACAACACAGACGATGACCTCATCCCTCCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21251
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114194 Essential Splice Site 652 752 16 19
Genomic Location (Zv9):
Chromosome 8 (position 19026410)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18471298
GRCz11 8 18507010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAGG[T/C]AATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTCA
Long Flanking Sequence:
CTGCCATCATTAAAAAAGCCTTTTAAATAAAGTATTAAATACATTGCAGTAGTTCAGTGCTTGTGTCATTTCACTGTTAATATGCATAAATCATTTATCAGATTTTTTTGTTTTGTTTTATTTTTATGTTTGTATTGTTTGAGTTTTTACAAAATCTGATTCAATTCCATGTTAAAAACTCCTTTAGGAATACTATCCCTAGGAAAAAAATGTTCATGTTACGTATTTTCTCTCGCTGTAGTTAAGCTGGTTGCGTTTTTGCATATCTTCTGTGTGTACAGTTTTCTGAAATGATTAAGTCATTAAATCTTACAATTTCCTTTTCATTTTTCTTAAGGAATTGGTAAATCTATTACTTTGTGGACGCGCTGTTTCAAACGTCTTTGATGATGAAATGAAGCTTGATTCCGGAAATGGAAATTTTACCCTTCTGAGGGGAATTAAAACACGATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAGG[T/C]AATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTCATCTTTTTTTGCTTTTCTTTTTCTAAAGGTTGGATCTCACCTGAAAAACCCCACGTTTCCAATTTGGGTGGTGTGCAGCGAGAGCCATTTCAGTGTTCTCTTTAGTCTCTCTAAAGATCTGGCGTCCGATCACTGTACGGAGAACGAGTTTGACTTGTACTATTATGATGGATTGGCCAACCAGCAGGAACCAATTAGATTAACAGTCTGTGAGTGTTTTCCTTTGCTTCAATGTTTTTCTGGACATAAGTGCACATACGAAACAAAACACCCGATTGTGGTGTTTCCGAAAACTAAATAAACTCAACCTTTGCACACCTGCTCCATAATTAGGGTTTATAATAAGTCTGTATTTAAAGAGAATCGTGTGTGTCTGAACAGATCCACATTCTGCTGCTAAGGCTGCTGCGCACAATGACAACACAGACGATGACCTCATCCCTCCGCTGGA
Associated Phenotype:
Not determined